Transcript

dbh-002

ID
ZDB-TSCRIPT-090929-6949
Name
dbh-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024020 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024020|OTTDARG00000019526|ZDB-GENE-990621-3 dbh|no_translation dbh-002 LG_ AL935290.10 Danio rerio protein_coding KNOWN, 858 bp
CGCAGATCTCCAGCATTCAGACTGTCAATACGAGCCCACA
CACTCGCTCAAGCTGCCAATTTAATGCTAACCTGCCAACA
GACATTCACTGGAGCTCTGCAAATAGCCTTTGTGAACGTG
TGTGTGTGGTGTTTCTCACAGGGCGATGCTCTGCTCACGA
CGTGCAGATTCAACACCGAGGACAGAAGCAAAGTTACTGT
GGGTGGTTTTGGAATTATGGAGGAGATGTGCGTCAATTAC
GTCCATTATTACCCCCGAACGCAACTTGAGCTGTGCAAAA
GCCACGTGGACACAGATTACCTGCAGAAATACTTCAGCCT
CATCAACAGGTTTCAGGGCCGCGAGAGCTGCAGTTGTCCT
CAGACCTCTGTGGAAGAACAGTTCTCCTCAGTGTCCTGGG
ACAGTTTCAGTGGAGAGGTGCTGAACTCGCTCTACGTCAC
AGCACCATTTTCAATGCACTGCAACCAGTCCACAGCGCAG
CTCTTTCCTGGTGACTGGGAGAAGCAGGAGATCCCGGTGG
TGACAGCGCAGCTTCAGAGAGCCCCATACCCATGTGAAAT
AAACAGGAGAGTGGCTTCTAATAATGACAGCCCTACAGAG
GTGCGAGCGGACAGCAGCGGCTGATCTGCACCTTTACCAT
CTGAAGCTCGATAACAGATCCACACAGCGGCCCGCTCATT
ACACTCTCCACAATTAATTACTCAATAACTGCTTTGTGTT
TAGACTGTTATTGAAGACTATGTTACGATTCGCATGAGAA
CACTAAAAAAAACTATTTATTCTTAGAAATTATCATTTAA
TTGTGCAAAATATGATAAAAATACAGCAAGCAGCAGCTAC
TGCAAAAAAAAACCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations