Transcript

med19b-202

ID
ZDB-TSCRIPT-090929-6872
Name
med19b-202
Previous Names
  • med19b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023935 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023935|OTTDARG00000019476|ZDB-GENE-040727-4 med19b|OTTDARP00000019826 med19-001 LG_ BX511158.5 Danio rerio protein_coding KNOWN, 1177 bp
AGACAGAACGTTACGGACGTTAAGTAATTGTCAACCGAAT
ACAAACGTCCATACAATTAAACCGTCGCAGGCTCGCAGCG
TAGTTTTTGTCATCATGACAGAAATCTTCTCCTCGTTGTA
TGGCCAGCCTGATTCCCAGGGCCCCGCAGGACCGTCCGCG
CTGGGCTTTGGCTCTGGGAAACCTCAGGTCCCCCAAAACA
TGGGCCCGATGTGTTTCCCGCATCAGATGATGGAAGAAGG
GGCTCCGGTCAGAAAACCGGCTGCGATGAACGAGCCCTTC
TATCTGCTGAGAGAACTGCCCATGGAAAATGAGCTGACGG
GACACACTAATCTCATCACGCACTACAACCTGGAGCACGC
GTACAACAAGTTCTGTGGGAAGAAGGTGAAGGAGAAACTC
AGCAACTTTCTTCCTGAGCTTCCTGGTATGATAGACAGCC
CAGGCATTCAGGACAACAGTTCTCTGCGCTCTCTCATCGA
GAAGCCTCCTGTGTGCAACAACTCTTTCAGTCCTCTGACC
GGAGCCATGCTCACCGGCTTCAGGTTACACACTGGCCCTA
ATCTGCTGGGATTTTTTGTGTATGTTTTATCTGACTCTAT
GTCTGTCTTGCTGAAGTTACCAGAGCAGTACAGACTGATG
CACATTCAGCCGCCTAAGAAGAAGAACAAACACAAGCACA
AACACCATCGACCTCAGGACCCCTTACCACCAGAAACTCC
GTCAGATTCAGACCATAAGAAGAAGAAGAAAAAGAAGGAC
GATGACCCGGACAGAAAGAAAAAGAAGAAAGATAAGAAAA
AGAAGAAGAATCGCCACAGCCCTGATCACCCAGGCATGAC
CGGAGCTCAGCCCAGCACCAGCAGTTTGAGATAAAACTGA
AAAACAAGAGGAAAGTGTTACAGTGAAGCACAAGCTGGAC
AATTGGGCTTTTTACCGGATGTCCCACAATTGATGTTACA
GTAAGAATCAGATGCCAGGTTTGTGTGTGTGTGTGTGTGT
GTATTGATTACGTAATGTATTAATTACCAGATGATCTGGT
AAAGCGTTATATTTGTAAGTGCCTCAGTGTCTATTTATGA
GTTCAATGAAAAATGTAACATTTTTCATTCAGCTTTTTTA
AACGTTTTTTTGTTTTTTGTTTTTACAAATAAAACAATCA
GCTGAGAAACTGGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations