Transcript

rps7-201

ID
ZDB-TSCRIPT-090929-670
Name
rps7-201
Previous Names
  • rps7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006213 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006213|OTTDARG00000005705|ZDB-GENE-040426-1718 rps7|OTTDARP00000005528 rps7-001 LG_ BX276180.5 Danio rerio protein_coding KNOWN, 688 bp
ACGCGCTTTTACCGGCCTCTCGCGAGAGTACGGCCTCTTC
CCAGGCCGTCGTTGAAAGAGACACAGGCCATGTTCAGTAC
CAGCGCGAAAATAGTGAAGCCGAATGGCGAAAAGCCAGAT
GAGTTTGAGTCTGGCATTTCCCAGGCTCTTCTTGAGCTGG
AGATGAACTCTGATTTGAAGGCTCAGCTGAGGGAGCTCCA
CATCACTGCTGCTAAGGAAATCGAGGTTGGTGGTAGCAGG
AAAGCCATCATCATCTTTGTGCCTGTGCCCCAGCTGAAAT
CTTTCCAGAAGATCCAGGTGAGGCTTGTGCGTGAGCTGGA
GAAGAAATTCAGTGGCAAGCACGTGGTGTTCATTGCACAG
AGAAGAATCCTGCCTAAACCCACAAGGAAAAGCCGCACAA
AAAACAAGCAGAAGCGTCCCAGGAGCCGAACTCTGACTAA
TGTGCATGACGCTATCCTTGAGGACCTGGTCTTTCCCAGC
GAGATTGTTGGTAAAAGGATTCGCGTGAAACTGGACAGCA
GCAGGCTCATCAAGGTCCACCTTGACAAGGCACAGCAAAA
CAACGTTGAACACAAAGTTGAGACATTCGCTGGTGTCTAC
AAGAAGCTCACAGGAAAGGATGTGATATTTGAATTCCCAG
AGTTTCAACTGTAAAGTGCAGATGACAAAATAAATTTGTT
TACTGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations