Transcript

cmlc1-201

ID
ZDB-TSCRIPT-090929-6157
Name
cmlc1-201
Previous Names
  • cmlc1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022932 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022932|OTTDARG00000018808|ZDB-GENE-030522-1 cmlc1|OTTDARP00000019124 cmlc1-001 LG_ AL845516.8 Danio rerio protein_coding KNOWN, 796 bp
CACGCATTCTGACATGTCAGTATATAAGCCCAACATGGGG
GGCTCTTCCAACACACATCCCAGCCTTTTCCCATCAGCAT
CATGGCACCAAAAAAAGTGGAACCCAAGAAACCAGAGCCG
AAAAAACCTGAGGCCAAAAAAGAAGAAGCCCCTGCTCCTG
CACCAGTTCCAGAGACACCCAAAGAGCCCGAAGTGGACCT
GAAAAGCGTCCCGCTGGATTTTAGCCCAGACCAGATTGAA
GAGTTCAGGGATGCCTTTACTCTCTTTGATGAAACGCCAA
CAGGAGAGATGAAGATAAGGTATGCCCAGTGTGGAGATGT
GATGAGGGCTCTGGGTCACAACCCTACCAATGCTGATGTA
TTGACGGTATTAGGGAAGCCCAAAGCTGAAGAAATGAACA
CCAAATACCTGGACTTTGAGACGTTCCTGCCAATGCTGCA
GCATATCTCAAGAGCCAAGGACCAGGGGACGTTTGAGGAC
TTTGTTGAGGGTCTGAGAGTCTTTGACAAAGAGGGAAACG
GAACAGTGATGGGTGCTGAGCTCCGTCACGTCTTGGCAAC
GCTTGGGGAGAAAATGACAGAGGATGAGGTGGACCGTCTG
ATGGCCGGACAAGAAGACGCCAACGGCTGCATTAACTACA
CGTCCTTCATCAAGCACATCCTCTCCGGGTGAGCCGACGC
TGCAAAGATTGCCGAATGAAATTGGAACTCTAAATGGCAA
CTGTCAAAACACTGGAAAGCAAATACGTCTTGTCTGTATG
TCTTGGAAAGCATCAAATAAAATCCATCCAAATGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations