Transcript

nr2f1a-201

ID
ZDB-TSCRIPT-090929-5936
Name
nr2f1a-201
Previous Names
  • nr2f1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022621 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022621|OTTDARG00000018608|ZDB-GENE-980526-115 nr2f1a|OTTDARP00000018924 nr2f1-001 LG_ CR751602.12 Danio rerio protein_coding KNOWN, 2994 bp
GGCTCCTTGACACGAGCACCATATAAGGCGCAGCGATCTC
CATAGAAACGTGTCAGTTTCAATAGTAGTGTCAAAGTTCA
CTATATACAGACATTCGCGCAGATCTCCGTTTCGGAAACA
TTGCTCCGCTGGTACTCCCGTTAAAACGCATTCTTTTTGG
GTCTCTGCTTCTTACATATTCCATTAGTTGCTTTTTTTCT
TTTCTTTTCCTACTGGAGAGGTGAAACTACATAGCCAGTC
GGGCGACGTTGCTTTTTTTCGCTGGACCAGATGAGCTTTA
TTCATGAACATAGATAGAGAAATCCGTTCTTCAGTGTTTC
CTCCTCTCCAACCGCGAAGACGGAGAGAGGAGCAAGGAAG
AAAAAAGAGGGGAATTTATTTTGCACAGCACTTTGGATCT
GCGGTCCACCAGAAAGCTATTATTTTTGCTTCAACGTGAA
GATTTTGTTTTTTACTGCGGTATTTTTTAAGAAAACTGTT
TTTTTTTATATTACGTCTGGGATCGCTTTCTTCATTCACG
ATTGGGTTCCCGAATGGCTGACTGCAATTTACCTTGGAAC
TGGCCTCCCGACAACTGCATATCCTGATCGGGTGCCTTTC
TATCGACTCCGGTATTTTGAATGTATTGACCATTTTCTGC
TTCTACTTTTTTCCCTATGAGATTGAGTGCTCCGATTTGA
ATTCGCGCTGCCGTTCGTCCAAGACTTCCCTTTTCCCTGC
TCCGATATCCGAGCGACCAGTTCGCTTGAAAGCACTTTTC
GGGCCCGAGATATGGCAATGGTAGTTAGCGTCTGGCGAGA
TCCGCAGGAAGACGTGGCTGGAGGACCTCCGAGCGGCCCC
AATCCAGCAGCTCAGCCGGCGAGGGAGCAACAGCAGGCGG
CGTCAGCGGCACCACACACTCCGCAGACCCCCAGTCAGCC
AGGACCTCCGTCCACACCAGGGACGGCTGGCGACAAGGGC
AGCCAGAATTCTGGACAGAGTCAACAGCATATAGAATGTG
TTGTTTGCGGGGACAAATCAAGCGGCAAGCACTATGGTCA
ATTCACCTGCGAAGGATGCAAAAGTTTCTTCAAGAGGAGT
GTCCGAAGGAACTTAACATATACATGTCGTGCCAACAGGA
ACTGTCCTATTGACCAACACCATCGTAATCAGTGCCAATA
TTGTCGGCTGAAGAAGTGTTTAAAAGTGGGCATGCGGCGG
GAAGCGGTTCAGCGAGGAAGAATGCCTCCAACCCAACCGA
ACCCGGGCCAGTATGCGCTAACGAATGGGGATCCTCTGAA
CGGTCATTGCTATCTCTCCGGATACATCTCGTTACTACTT
CGGGCCGAGCCTTATCCTACGTCTCGCTATGGCAGCCAGT
GCATGCAGCCCAATAATATTATGGGGATCGAGAACATCTG
TGAGCTTGCAGCTCGTCTGCTCTTCAGTGCAGTGGAATGG
GCAAGGAACATCCCTTTCTTTCCCGATCTGCAGATCACCG
ACCAGGTGTCATTGCTCAGACTGACATGGAGCGAGTTATT
TGTGCTAAACGCGGCTCAGTGTTCCATGCCCCTACATGTG
GCCCCACTGCTCGCCGCTGCCGGCCTGCACGCCTCGCCCA
TGTCGGCGGATCGCGTCGTGGCCTTCATGGATCACATTCG
TATCTTCCAGGAGCAGGTCGAGAAGCTCAAAGCACTGCAC
GTCGATTCTGCTGAATACAGCTGCATTAAGGCAATAGTGC
TCTTCACGTCAGACGCTTGCGGCCTGTCAGATGCTGCACA
CATCGAGAGTCTGCAGGAGAAGTCTCAGTGCGCCCTGGAG
GAGTACGTGAGGAGCCAGTACCCGAACCAGCCCAGTCGCT
TTGGCAAGCTTTTACTGCGACTGCCTTCTCTCCGCACTGT
CTCTTCGTCAGTAATTGAACAGCTGTTCTTCGTTCGCTTG
GTAGGTAAAACTCCCATTGAAACCCTCATCAGGGATATGT
TATTATCCGGGAGCAGCTTCAACTGGCCCTACATGTCCAT
TCAATGATCCGAATGAGCGAGTGAAACAAAAAGACTAAAG
GACCAAAATTCTGCAAGCCCTTTCAAGAAGACTATATATA
TAGGACCTAATTTCTGACCACTTAGGAAGACACTTTTTTG
TCTTCTGGGACCGAATGGAATATGAAATGTACAAAGATTA
AAGAACTGGACGTACCCCCTGTAAATCCATCGTCGTCATC
AAGAACACTCTCCATTTTGTAAAATACTAGTCTTTATTTT
ATTTTCTTTTTTCTCTCATTTTTTTCTTTTTTCTTTTTAT
TTTTTTGTAAAGAACAAAATACGTACAAATAAAACGAAGA
ACATCATATGCGCAGTAAATGAGCAAGACTTAGCGGGAAA
GAAATTTCCAAGCAATTATAAGAAATGTCCTGTGTCTATG
TATCTCTGTTTTGTATTTTTTCTGGTTCTAAACCAGTTTT
TTTCTGTGATTCTATACTAATGATTTTGATATAACCTTTT
GCTTCTTATAATGAGTGCGATATATGTTGTTGAAGATGTT
CTCCAAGAATTAAAATTGAAGTGAGAATTTAAAAATAAAG
AAAAACATTAGACAAATAAGACACAGTCTAATCGCAATGA
CAATTTTACTGATGGTTGAACCTTCCCCCACTTTGATGCT
ATGGACATGCAACTTCGGCAAATCTGACCTCATGGACATT
TTAAGGAGAGGACACCGGTGAAACTTTTTCTTGGTCGTAT
GTGTGTGCGAGTGTGTGTGTGTGTGTGTGTGTGTTGAGTC
AATCATCAGTCAGAGAGAAAAGACATGATAAATCAAAAGC
ACTTTTAATATATCATTTTCAAATACATTTTGTTTGTTTC
GTCTTGATATTTCCGCTATTTCTTTTTTATTGAATGTTGC
CTTTCATTTCTGCTCAATCCATGATATGCCTGTGCAGAAG
GGTCGCGTGAAGTTGTGTGATGGTGACTATACTATTAAAA
AGGAAATAGGCAACAATGTCTCGCTCTCAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations