Transcript

fsta-202

ID
ZDB-TSCRIPT-090929-5789
Name
fsta-202
Previous Names
  • fsta-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022443 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022443|OTTDARG00000018483|ZDB-GENE-990714-11 fsta|OTTDARP00000018805 fsta-001 LG_ BX537294.4 Danio rerio protein_coding KNOWN, 2024 bp
GTTCATTCAGCACTGCCTGAGTAAGAAGATTACTTTTGCG
CTGCTCGTCTATCTACTCTTTCTCTCTTTAAACATGCTAA
GGATGCTAAAGCGTCAGCAGCTCCACCCGGGAATGATTTT
ATTACTCTTTTGGCTCTGTTATTTGATTGAAGATCAAAAA
GTGCAAGCTGGTAACTGCTGGCTTCAACAGGGCAAGAACG
GGAGATGTCAGGTTCTCTACATGCCTGGGATGAGTCGGGA
GGAATGTTGCCGGAGTGGGAGGCTCGGTACATCTTGGACT
GAGGAAGATGTGCCAAACAGCACATTATTCAGGTGGATGA
TCTTCAATGGCGGGGCTCCAAACTGCATACCTTGTAAAGA
GACGTGTGATAATGTGGACTGTGGTCCTGGAAAGAGATGC
AAAATGAACAGGAGGAGTAAACCTCGCTGCGTCTGTGCTC
CAGACTGCTCTAACGTCACCTGGAAAGGGCCCGTCTGTGG
CTCAGATGGAAAAACATACCGGGATGAATGTGCCCTTTTG
AAGTCCAAATGCAAAGGGCACCCAGATCTGGAGGTCCAGT
ATCAAGGCAAATGCAAAAAGACGTGTCGTGATGTCCTGTG
CCCGGGAAGTTCAACTTGCGTGGTGGACCAGACAAACAAC
GCCTACTGTGTGACATGCAACCGCATATGCCCAGAGGTCA
TGTCTCCAGATCAGTACCTTTGTGGCAACGATGGGATTGT
TTACGCCAGCGCATGCCATTTAAGAAGAGCCACGTGCTTG
CTCGGTAGATCCATCGGCGTGGCATATGAAGGAAAATGCA
TCAAGGCCAAGTCATGCGATGATATCCACTGCAGTGCAGG
GAAGAAGTGTTTATGGGATGCAAAGATGAGTCGCGGGCGC
TGCGCAGTTTGCGCCGAGTCGTGCCCAGAAAGTCGCTCGG
AGGAAGCTGTGTGCGCCAGCGACAACACCACGTATCCCAC
CATTACGGAAGACCAGGAGGATGACGATGACGAGGAAGAC
CAGGACTACATGGCTTATGTCCAATTATCACCTGTACTGG
ATGGATAAAGCACCATCAACCAGTGGAACAGTCCTAGGGC
GAGGAGTCATGTCCACACTGTACATATGTGTATGCTAATT
TATTTTTCAGAGAAAAAAGAAAGAAGTATACATGTAGTTC
AGTCTGCTTGATGTTTATTTATACAGTGTTCTGTTTTATA
ATTTATACATTTACAGTGTCCGGCTTACTTGTCTATCATG
TTTTTCCCTTTTCTTTCTTTAGTTTTGTTTTTATATATAT
TTTTTATTATGACCGAGAAATATATTTGTCCAAAGAGAAG
CAGTGTTATTTATTGTGAGGTAAAATGCTATCATGTAAAG
TGTGAGTCTTCTGCAAGCTGTAAATTGCATTCCTTGAGCT
GTACAAATGCTTATCAGTGTCAATTCTGTATCACAGATGT
TTATTTCACACATACCTGCATGTTAGCTTGTGTTTATTTA
TTGGAAAAAAATGGAAAAACGCATAGGACAAAAAAAAAAG
TGTCACTCTTTAATGTACGTGTATATTTCTGGTTTTGTTT
ACAGTTCAGTGTAACTGACCAAAGGGATTTTCTTAAATGT
TCTTCAATGTTAATGTGATATGGTGCAGCAGGATGACATT
GGAAATGTGTTGTTTCTCATTTAGAAAAGCCCTGCTGATT
CTGCTGTCCTTCATAAACAGCAAGAAATGGGCAGTGGGTG
ATGATTGTTTCAGAAAACTGTGCCATGCAACTGTTTTTGT
CTTGTTTTTGCCAATATTCAGCTCTATATTGCTCTTGCGG
AGCGAACACAAGGTCAACGGAGGACTCAGTATCGATATAT
AAAGCGTTCACCTTTTCACTTTGTTGTTGAAATGCTTTTT
TTTATTTTCAGACATCTCAAGATAAAAACGAAATTCAGTT
ATAAATATATAGTTTTGTATTTTTTATGTAAATGTCATAT
GTATATACAAAGTTTGATGTATTTGTACAGATATTAAGAG
TGAAATCAATAAAAAATACTTATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations