Transcript

iqch-203

ID
ZDB-TSCRIPT-090929-3482
Name
iqch-203
Previous Names
  • iqch-002
  • si:dkey-246a16.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016577 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016577|OTTDARG00000013218|ZDB-GENE-050419-242 iqch|OTTDARP00000014069 DKEY-246A16.2-002 LG_ BX247951.11 Danio rerio protein_coding NOVEL, 580 bp
TGGACGGGGAACTGCTTATGTTGATGTCTGCCATCTGAAA
AGTCGCCCATGGGCACAACAGGAGTTTATCCGCCATGAGC
CTCAACAATGGAGAACATCACAGTCTCAGGATTCTGTGAT
GATCAAGTTTTTAGAGGAAGTTCCTCATCTTTTGGCATCT
TACGCCAGGCTGGCAAACACATCCTGCTACAAAACATGGG
CCTGCTTCCTTGAACACTTCCTCAAAGAAGGAGGAGTGAT
AGAAGCCTTTCCTCCTTCACAGAGTTTGACGTGTCTGGCG
GTGGATCTTCTGTTGGAGCCAGGCGGAGATGTGCTCATGC
TGTCCTGTGGAGATCAGCTGCGTGGGCCTAGTGGCTTGGA
GGTGTTGGGCTGCACTGTACCACAGACCTCCATCTGCCCT
GAAGTCCTGCACTCCGTCTGCACTCGTGTGGGTCAGGCCT
GTCAGCAGCGCTCCATCATGGGCCACATCTCTTTAGATCT
GGTCACTTTCCTGGATCCCAACAACCTGGAGCAGCAGGTT
AGAGGCCAGCACAGTACTTAGTCTTTGAAACCCTTCTCAA
AATAAAACAAACTATATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations