Transcript

large2-202

ID
ZDB-TSCRIPT-090929-3333
Name
large2-202
Previous Names
  • gyltl1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016152 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016152|OTTDARG00000013587|ZDB-GENE-050419-253 gyltl1b|OTTDARP00000013715 CH211-282N12.1-001 LG_ BX908385.10 Danio rerio protein_coding NOVEL, 2253 bp
ATGCTCTGCCCCTGTCGAGGGAAGCTGAAGTTGCTGGTGG
TGTCTCTGAGTTTCGTCATCCTGTTCACCTGGCTTTACCT
GCTCGTGGGGAACTCGGAAAACGGACGTTCGCTGCTCCTC
TCTGCATGTTTGGTGGAGTCTACTGAAGCGCGGCTGCTGG
AACGGGACGTCCTGGCATCACGGGTTCGTGAAGTGGAGGA
GGAGAACCGCCAGATCCGTCTCCAACTCAGCCAATCGCAG
GGTTTGGCCGGTCAGCCTGCAGAGGGGAACTATGGGAACC
AGCAGTGGGTGGCATCGGCAGACACCGGTCCAGAGGATGT
GGAGAACACAGCTGAGGAGCGGGCAAACCACAGCGAGTGC
TCACGCTCGCCCACTGCTGAGAAGTGTGAGTTGCTCCACG
TGGCATGTGTGTGTGCAGGTCACAACGCCAGTCGAGACGT
GGTCACTCTGGTCAAATCTATCTTGTTCCACAGGAGAAAC
CCACTGCACTTTCATTTCATCACAGACACGGTGGCCAATC
AAATCCTCAGCACTCTGTTCCAGTCATGGATGGTGCCGTC
GGTACAAGTCAGCTTCTATGATGCTGATGAACTCAAATCG
GAGGTGTCGTGGATACCAAACAAACACTATTCAGGAATTT
ATGGCCTGATGAAGCTCACTCTCACCAAAGCTCTGCCATC
CAACCTTTCGAAGGTCATCGTTCTCGATACGGACATCACC
TTCGCCACAGACATCGCCGAGCTGTGGGCCATTTTCCGCA
AGTTTACTGAGAAGCAGGTGATTGGTCTGGTGGAGAATCA
GAGCGACTGGTACCTGGGCAATCTGTGGAAAAATCACAAA
CCCTGGCCAGCCCTGGGGCGAGGATTTAACACCGGTGTGA
TTTTACTGTACCTGGAGAGACTGCGGCGGATGGGCTGGGA
ACAGATGTGGAGACTGACAGCAGAGCGAGAGCTGATGAGC
ATGCTTTCCACATCCCTCGCAGATCAGGATATATTCAACG
CTTTCATCAAACAGAACCCAGTGCTGGTGCATCAGCTTCC
CTGTTTCTGGAACGTTCAGTTATCAGATCACACTCGCTCT
GAACAGTGTTACACTGAAGTGTCCGATCTAAAGGTCATTC
ACTGGAACTCTCCTAAAAAGCTGAGGGTGAAAAACAAGCA
TGTGGAGTTTTTCCGGAATCTTTACTTGACGTTCCTGGAG
TATGATGGGAATCTTCTGCGACGAGAGCTGTTCGGATGTC
CCAGTCAAGCCAGCTCAGAGAGCACAGTGCTCCAGCAAGC
TCTAGAGGAGTTAGATGAGGACGACCAGTGCTATGACTTC
CGGAGGGAGCGGATCATGCTGCACAGGGTACACCTCTACT
TTCTGCAGTACGAATACAGTCCTACAGACGATGGCACGGA
CATCACGCTGGTCGCTCAGCTCTCCATGGACAGACTGCAG
ATGCTGGAGGCCATCTGCAAACACTGGGAAGGCCCCATTA
GTCTGGCTCTGTACATGTCAGACGCCGAGGCCCAGCAGTT
TCTGCGGTATGCCCAGGCCTCCGAAGTCCTCAAAAACCGC
AAGAATGTGGGCTATCACATCGTCTACAAGGAGGGTCAGT
TCTACCCGGTCAACCTGGTGCGCAATGTGGCGCTTCGCAA
CGTCAACACACCCTACGTTTTTCTGACCGATGTTGACTTT
CTGCCCATGTACGGCCTCTACGATTACCTCAGAAAAAGTA
TAGTCCAGCTGGATATGGCCAATACCAAGAAGGCTCTGGT
TGTGCCTGCCTTTGAGACGTTGAGATATCGCCTTTCCTTC
CCCAAATCCAAAGCAGAGCTGTTGTCAATGCTGGACATGG
GGACTCTCTACACCTTCAGGTATCATGTCTGGACAAAGGG
TCACGCGCCAACCAATTATGCCAAATGGAGAACAGCCACG
ACACCATACAAGGTGGAGTGGGAGGCGGATTTTGAGCCGT
ATGTTGTCGTGCGCAGAGACTGTCCCGAGTACGACCAGAG
GTTTGTTGGCTTTGGCTGGAACAAAGTTTCCCATATCATG
GAGCTCGATGCTCAGGAGTATGATCTTATTGTGTTACCAA
ATGCCTTCATGATCCACATGCCCCACGCGCCCAGCTTTGA
CATCTCCAAGTTTCGCTCCAGTCCGAGTTACCGCTACTGC
TTGACTACACTAAAAGACGAATTCCACCAAGACCTTTCTC
GAAAGTACGGATCCGCTGCTCTCAAGTACCTCACAGCACA
GAGGAACATCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations