Transcript

tuba1a-201

ID
ZDB-TSCRIPT-090929-22507
Name
tuba1a-201
Previous Names
  • tuba1a-001
  • tuba1l-001 (1)
  • tuba1l2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026990 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026990|OTTDARG00000021268|ZDB-GENE-090507-4 tuba1a|OTTDARP00000022121 tuba1l2-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 1537 bp
GTTGTCGAGCTGTAAGATCTCTCCGCCAAGACTTCTTTCT
TCCCCGGCCAAGCAACACTACTAGAAACAATGCGTGAGTG
CATCTCTATCCACGTTGGTCAGGCTGGAGTTCAGATCGGC
AATGCCTGCTGGGAACTGTATTGTCTTGAGCATGGCATCC
AGCCGGATGGGCAGATGCCCAGCGACAAAACCATCGGAGG
AGGTGATGACTCCTTCAACACCTTCTTCAGTGAGACCGGA
GCTGGAAAACACGTCCCTAGGGCTGTCTTTGTAGACCTGG
AGCCCACTGTCATTGATGAGGTGCGCACTGGGACATACCG
TCAGCTGTTCCACCCTGAGCAGCTCATCACAGGAAAGGAA
GATGCTGCTAATAACTATGCTCGTGGTCACTACACTATTG
GAAAGGAAATCATTGACCTGGTGCTGGACAGGATTCGCAA
ACTGGCTGACCAATGCACAGGTCTCCAGGGTTTCCTGGTC
TTCCACAGCTTTGGTGGTGGCACTGGTTCTGGCTTCACCT
CTCTGCTGATGGAGCGTCTGTCTGTCGACTACGGCAAGAA
GTCCAAGCTTGAGTTCTCCATCTACCCCGCTCCTCAGGTC
TCCACCGCTGTGGTAGAGCCTTACAACTCCATCCTGACCA
CCCACACCACCCTAGAGCACTCTGACTGTGCCTTCATGGT
AGACAATGAGGCCATTTATGATATCTGCCGTAGGAACCTT
GACATTGAGCGCCCTACTTACACCAACCTCAACAGGCTAA
TTGGCCAGATTGTGTCCTCCATCACAGCCTCCCTTAGGTT
TGATGGTGCCCTCAATGTGGATCTCACTGAGTTCCAGACC
AACTTGGTGCCCTATCCTCGTATCCACTTCCCTCTGGCTA
CCTATGCCCCAGTGATCTCCGCAGAGAAGGCTTACCATGA
GCAGCTCTCTGTGGCTGAAATCACCAATGCTTGCTTCGAG
CCGGCCAATCAGATGGTCAAATGCGACCCACGTCACGGCA
AGTACATGGCCTGCTGTCTGCTGTACCGTGGTGACGTGGT
GCCCAAAGATGTGAACGCCGCAATCGCCACCATCAAGACC
AAGCGCACCATCCAGTTTGTGGACTGGTGTCCCACTGGTT
TCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTTCC
AGGTGGTGATCTGGCTAAAGTGCAGAGGGCCGTGTGCATG
CTGAGCAACACCACAGCTATTGCTGAGGCCTGGGCTCGTC
TGGATCATAAGTTTGATCTGATGTACGCCAAGCGCGCCTT
TGTGCACTGGTACGTGGGTGAGGGTATGGAGGAGGGCGAG
TTCTCTGAGGCCAGGGAGGACATGGCTGCCCTGGAGAAAG
ATTATGAGGAGGTTGGTGTCGACTCCATCGAGGGTGAGGG
AGAGGAAGAGGGCGAGGAATATTAAGTGACACAAATAACA
TGCAGGAATCATGAAATTCAAACAGTGAAAATTGGACAAC
CAATGGAATTATGATGGTACAGTTCTTTGAGCTGAAATAA
ACCTCCTTTCCAAACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations