Transcript

smarcd1-201

ID
ZDB-TSCRIPT-090929-20081
Name
smarcd1-201
Previous Names
  • smarcd1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039836 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039836|OTTDARG00000029076|ZDB-GENE-030131-1835 smarcd1|OTTDARP00000031851 smarcd1-001 LG_none CU929149.6,CR450748.10 Danio rerio protein_coding KNOWN, 2697 bp
ACTAGTTTCAAGTCTCACCGGTGGTTCTCTGTCTGTTTGC
GGCTCGCGGAGAAGAAGATGGCGGCGCGGAGTGGTTTTCA
GCCTTCGACACCCGGTGGCGGCGGAGCCCCGATGGGACCC
GGGCCGCCGGTAGCCGGAGCAGGACCCGGTATGGGTCCCG
GTACACCCTCAGGAAGGATGGGACCAGGCGGCCCGCAGAA
CCACATGTACCGATCACCGATGCCCGGTTACCCGAGACCA
GGAATGCCTCCAGCCAGTCGTATGACTCCTCAGGGACCCT
CCATGGGGCCCCCAGGTTACGGGGCCAGTCCTGTTTCCCG
CCCCGGCATGCCAGTAATGGACCCGTCCCGCAAACGTCCA
GCGCCAAATCAGATACAGCAGGTTCAACAGCAAAATCGCA
ACCAACATGCCAAGAAGAAGAAAATGGCAGATAAAATACT
ACCTCAAAGAATCAGAGAGCTTGTCCCAGAGTCTCAGGCT
TATATGGACCTGTTGGCGTTTGAGAGGAAGCTCGACCAGA
CCATCATGCGCAAACGACTTGATATTCAGGAAGCTCTCAA
GAGACCCATTAAGCAAAAAAGAAAACTCCGAATATTTATC
TCCAACACATTCAACCCTGCCAAGCCAGATGCAGAGGATG
GCGAGGGAACTGTTGCATCTTGGGAGTTGCGTGTGGAGGG
GCGGCTTCTTGAGGATACCGCTGTGTCCAAGTATGAAGCC
ACCAAGCAGAAGAGGAAGTTTTCTTCTTTTTTCAAGTCTT
TAGTGATCGAGTTGGACAAAGACTTGTATGGACCTGACAA
TCATTTGGTTGAGTGGCACAGAACAGCCACAACTCAGGAG
ACAGATGGATTTCAGGTCAAGAGGCCTGGGGATGTTGGGG
TCCGCTGTACTGTACTGCTCATGCTGGACTACCAGCCCCC
TCAGTATAAGCTGGACCCCCGCCTGGCCCGGCTGCTGGGG
ATTCACACTCAGACCCGGCCTGTGATCATTCAGGCTTTGT
GGCAGTATGTGAAGACCCACAAACTCCAGGACCCTCATGA
ACGAGAGTTCATCAACTGTGACAAATACCTCCAGCAGATT
TTTGAAACCCAGAGGATGAAGTTCTCTGAGATCCCTCAGC
GGCTGCATGCCCTACTGATGCCTCCAGAACCAATCATCAT
CAACCACGTCATCAGCGTTGATCCCAATGACCAGAAGAAG
ACTGCATGCTATGATATTGACGTGGAAGTGGACGACACCC
TGAAGACCCAGATGAACTCTTTCCTGCTTTCCACGGCCAG
TCAGCAGGAGATTGCAGGCCTCGACAACAAGATTCATGAG
ACCATCGAAACCATTAATCAACTGAAGACTCAGAGGGAGT
TCATGTTGAGCTTTGCGCGAGACCCGCAGGGCTTCATCAA
TGACTGGCTCCAGTCGCAGTGCAGAGACTTGAAGACGATG
ACGGATGTTGTCGGAAACCCAGAGGAGGAAAGAAGAGCCG
AGTTCTACTACCAGCCTTGGGCTCAAGAGGCTGTGTGTCG
CTATTTCTATTCAAAGGTCCAGCAAAGGAGACAGGAGCTG
GAACAGGCTCTTGGCATTCGAAACACATAAGCAAGCCTGT
GGCCGTTACGACACAGGACCAGAAGGGATTCTGGGTAGCG
AATTTCCTGCTGCTTGGCACTGCAGATGCTGATCACTACA
GTTTTATTACGGTTTATCTTGTGCTGTCCTGCTGTAGCTG
CCCAGGAGTGACCCTTCATAAGGAAATTACCTTATTTTTG
TTGTGACTCCGCCAAACTAACAAACCCCTTGAAATTCTGC
TGTCCCACTTGATTTTTACCTGATTCAAGCTAGATGATTT
AGCGATGTTGTTGTTTTCCGACCAAACTGACTTGCTTTTT
TTTTTTTACCGCTAATATCGGAACTCCAAACAAAAATGGT
AAAAAGTATTCTCCGTTCATGGCTTCTTGGAGTCGTTTAA
TTTTGAAATGATCGATATTGTCTTTTGATATCTTAATGTT
CTCATAATATGAACTTTATGAAGATCTAGTCTAGTTAAGC
ATAGATGACTGATAATGATGTAGTGTAGTACCTCAGCTCT
CTGAAGATGAATTATTCGGAGGAAGTTCCTTAAACGAGTG
CGTTAAAGGTGGGCTCACTGGTTAACATTCTCTGCAATGA
CTTTGAGAACTCGTCTGTTCAGTAACCGTTTTAGATCCAC
AAGATTAGATGTACTGCTGATCCACCTGTTTGATTACAGG
TCTGTTGGGCACAAGCTTTGTCCTGGCCTGTAAAGTACTT
CCACTCTAACCTCGCTGTGATATGTATTAATATATTTAGA
GAATTGCCTATATGGTTTGTTGGTTCGTTTAATTAATTTT
CATTTTGTCATTCTGAAAAGTAACATGAAATAAACCTGCC
AATGCAAGTACTACCTGTCCATGGCTACCCAAAAATCATG
TTTAGGAATACTATCAAGTGATTGAATATTTAATCGATGC
ACTGCAGATAGGCCATGGGTTCTTCCACTAAAGTAATTCA
AGCATTTAGAAGCCAAGTGCTAAAAACTTTAACATTCTGA
GTAGTTTAAGTTTTCTTTAAGTCATGCGTTTGCTTATTTT
ATATCTTTTTAATCCTTTTTTTCCCCTTTAATGGACCAAA
TGTTGTATTTCTGTTAGCCCTTGTGTTATAATAAAGATTA
TCTTGTATTGATGCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations