Transcript

esrrga-201

ID
ZDB-TSCRIPT-090929-19742
Name
esrrga-201
Previous Names
  • esrrga-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039446|OTTDARG00000028830|ZDB-GENE-030821-2 esrrga|OTTDARP00000031551 esrrg-001 LG_ CT027582.16 Danio rerio protein_coding KNOWN, 1991 bp
GCTGTCACCGGGAGAACGGTCCTGTTAATTGCACTGCTCA
GTCACGGAAGGGAGAGAGAGGAGGAGGAGACACAGAGAGA
AAGAGAGAGAGAGAAAACTTTAATTTATAGAAGAGGTTTG
CTCAAACGATGATCGCAGAGCGCACATGGATTCGGTAGAA
CTTTCGCTCCCTGAGTGTTTTTCCCTGCACTCCGATCAAC
AAATGAATTTATCAAAGGCCCAAGTTAATAGCGAAGATAA
GTACGCCAAATGCGGCGCTTGGAGAACGCAACAGCAATAC
GACATCGAGGCCAGTCACATGCGTGATGCACATGCTCTAT
ATAACCAAAGGCTGCTCTGCAGAATGTCCAACAAGGACCG
CCACATTGAGTCGAGTTGCCCCTCCTACATAAAGACGGAA
CCTTCCAGCCCCGCCTCACTAACGGACAGCGTAAATCACC
ACAGCCCCGGCGGCTCCTCAGACGCCAGCGGTAGCTACAG
CTCCACCATGAACGGCCATCAGAACGGCCTGGACTCACCC
ACTCTTTATGGCCCAACAGGCGCTCTGGGTCCCAGCGGAA
CTGGTGCCAAGCGTTATGAGGACTGTTCCAGCACCATCAC
GGAGGACTCACAGATTAAATGCGAGTACATGCTGAACTCC
ATGCCCAAACGCCTGTGCCTGGTGTGCGGGGACATCGCTT
CTGGTTACCACTATGGCGTTGCCTCCTGCGAGGCCTGCAA
GGCCTTTTTCAAGAGGACCATTCAAGGAAACATCGAGTAC
AGCTGCCCCGCCACCAATGAATGTGAGATCACCAAACGTA
GAAGGAAGTCCTGCCAAGCCTGCCGCTTCATGAAGTGTCT
GACCGTCGGCATGATGCGAGAAGGTGTTCGACTGGACCGT
GTTCGCGGTGGAAGACAGAAATACAAACGCCGGATAGATG
CAGAAAACAGCCCCTATTTGAACCCTCAACTGGCTCTGCC
TCCCAAAAAGCCATATAACAAGATTGTGTCTCACTTGCTG
GTGGCGGAGCCGGAGAAGATCTACGCCATGCCTGACCCGA
CAGTGCCCGACAGCGACATCAAAGCCCTGACCACGCTCTG
CGACCTGGCAGACCGAGAGCTGGTGGTCAACATAGGCTGG
GCCAAGCATATCCCAGGCTTTTCCACACTGTCACTGGCGG
ATCAGATGAGTCTTCTGCAGAGTGCGTGGATGGAGATCCT
GATCCTACGTGTCGTCTACCGCTCACTGTCTTTTGAGGAC
AAGTTGGTGTACGCTGAGGACTACATCATGGATGAGGATC
AATCCAAACTGGCGGGTCTGCTCGACCTGAATAATGCCAT
TCTTCAGCTGGTGAAGAAGTACAAGAGCATGAAGCTGGAG
AAGGAGGAGTTTGTCACTCTTAAAGCTATAGCCCTGGCTA
ATTCAGATTCCATGCATATAGAGGATGTGGAAGCTGTGCA
GAAGCTCCAGGATGTGTTGCACGAGGCCCTGCAGGACTAT
GAGGCAGGTCAACATGTAGAGGACCCGCGCCGGGCCGGCA
AGCTGCTCATGACCCTACCACTGCTCCGGCAAACGTCCAC
CAAGGCAGTGCAGCACTTCTACAGCATCAAACAGGACGGC
AAAGTGCCCATGCACAAACTGTTTCTGGAGCTGCTGGAGG
CCAAGGTGTAACTCCGCCCCCCCCCAGCCCCACCCCATAC
CCACAGAGAGCTGGAGGTGGGATGTCTCTGACTCCGCCCC
TTCACCCAGCCAGACACTGACTAACTCTCTGCCGCAGATC
GTGAAACATTTGTCTATAAACTTTATCAAATAATAACTAA
AAACATAACCTTAACGGTACTTCTAATTACTGACAATGAT
GCGTAAATATAAGAATGATTTAAAATGTGATTATTGAGAA
AGACATACAAACTATGAAGTGGGAAAAAAGTGACAGCAGT
GAAACCAGCCGTTGAAACTTGTTCCTCTCGAAAATCTGAT
GCTGAGGTTTTTCTTTTTGTGCTATTGAGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations