Transcript

chodl-201

ID
ZDB-TSCRIPT-090929-19619
Name
chodl-201
Previous Names
  • chodl-001
  • zgc:110088-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039319 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039319|OTTDARG00000028758|ZDB-GENE-050417-36 chodl|OTTDARP00000031456 CH211-80N22.5-001 LG_ CT574587.12 Danio rerio protein_coding KNOWN, 1382 bp
GCAGAAGCAGCGGCGCGCTCGCGAGTGGACGCGCGTGTCA
CTCTCTCTCTCTCCGCATTTCAGAGGCGTTTTTGTGAAGT
GTAAGCCCAGCTCGTTGGAAACCATGTCTTTGAACACTAT
GAAGAAGAGACTTTGCCAATAAATGTTTTTAAAAATCGCT
TGACTGGAGCAAGTCTGTGTGAAGTTCACTCCATCCTCGA
CTCAAGGGAAACACGAGGATGCGCGCGACACTCAGGATCC
TTTGTGCTTTGACTTTTCTGGTCTCGTGCAGCCGTGGCGC
GAGAGTTGTGAGCGGTCAGACAGTGTGTCAGGGCAACCCT
GAACACCCGTGCTATAAGATTGCTTACTTCAAAGACGTGT
CGAGTCGTGTTGCGTTCTGGGAGGCTCTGCAGGCATGTGA
AATGGACGGCGGTTCGCTGCTGAGCATTGAGAACACAGCC
GAGCAGAAGCACATTGAACACCTTCTGCGAGAGCTCAGCG
TCTCCTCCTCGACTGGTCCTGCCAGCATTACAGACGGAGA
CTTCTGGATCGGCCTGACCCGTGAGGAGGGTGATAATGCA
CAGGAGCCCGGCGCCTTCGCCTCCTGTCCCAATCTGTACA
GGTGGACTGATGGAAGTGTCTCGCTGTTCAGAAACTGGTA
TGCTGATGAACCATCCTGCGGAGGAGAAGCGTGTGTGGTT
ATGTATCACCAGCCTACAGCTCTGGCCGGGCCTGGAGGAC
CGTATCTCTACCAGTGGAACGACGACAGGTGCAATATGAA
GCACAATTTCATCTGCAAGTATGAACCAGAAAGTCATCTG
GTTAAAGTGCAGAGTGATAGGCCTGGAGGGCATGATGTTG
ATCTTTCCACTGAAGATAAAGAGGACAGGAGAACACCACC
CACTGATGAGGATGAGAGCCCTCGACTTATAATAGCCGGG
CCTTCAAGTATGCTGCTAATCTACGTGATTATCCCTACCA
TCCCTCTCCTCTTGCTGATCCTGGTGGCTTCAGGGACGTG
CTGTTTCCAGATGTTGAGCAAGAGCAAACCACGGACCAAA
ACTAGCGTCAACCAATCAACTCTCTGGATCTCCAAGACGC
CAAAGATAGACAGTGGCATGGAGGTCTAATTCCCCATTCG
TCTGCACCTTCCTGCTAGCAACATGTTTATCAAGTTGTAA
GTCCAAACAAGAAAACAAGTGAAGTTGACACAGGTATCAG
ATTTCTGTACAGATGTCAGTTCACTTCCACTGACCTGCAT
TTCACGTGTCCTGTCAGACAGTCAAATACTAATTGGCACC
AAACACAGTGGGCAATTAAATTACAGTAATTAAAGCAAGT
ACAAGTGGGAGCCACATAAAAAGAGGAATTAACAGAGCCT
GCGACACAGTAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations