Transcript

kitlga-202

ID
ZDB-TSCRIPT-090929-18993
Name
kitlga-202
Previous Names
  • kitlga-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038627 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038627|OTTDARG00000028394|ZDB-GENE-070424-1 kitlga|OTTDARP00000030946 kitlga-002 LG_none BX901919.9,BX323796.15 Danio rerio protein_coding KNOWN, 801 bp
CGAAACGGTTTGCCTGATGACCCCGAAAAAGGGGCATTTC
TTTCAAAAGTTTTGGAGAGTAATCTCATGTGGCTCCTCAC
CATCCCGTTTGCAATCGCAGTGGTGGTTTTGCTGGTCTGG
AAGATTAAGTCCAGAAGAAACACCCCCCAAACTGACCGGA
GTCCAGAAGAAGGTCCCGCTCTGTTCTCAGGAGAGGAAGC
CAATATATCGCCATTAGATGTGGGGATATCTGAAAAAAAC
AGATTAAATATTATCATGGATGTGTAAATCCAGCCCCAGC
TTAAGCAACGCAGGAACAAAGAACCACCAAGCAGTGAAGG
ACGCATGACTGGCCTGAAACGCAACGAACTGCTCTTTGAG
AACTGATGCCCTCTTTTATCAACCACTGCTGAACCCTTTG
GGGTAAAACGGTTGCTCCTTCTGAGAACTTCATGCTCTTT
AAAGCTTCCTTCTCCTCGAAAAAGAGACTGTGCAGGAGGA
ATTCGACGAAAAGCAGAACAAAAGCAACATGCGATTGGAT
TCACCTAGAGATGTCAAATAGCCAAGTGCATTTTTTTCGA
GCGCAGGAGCCGCAGTTCAGAAGGAGGGCAGCCATTTTTG
TTGCTTGAGAGCAGATGGCTGACTAAAAGGAGTTTAAGCA
GAAGTGACTACCTCCAGCTGCTCTGGTTCATCTCCTTATT
TCTTTCTTTGCTTCGTCTTTTTTTTTCCTTCTTCTTTTGG
GCTGGCTGTCCAGATAGACACCTTTTCACTTTTTTTTTTT
TTTTGGAGTGCTTGAATCAGTAAAGTCGTTCTCAGATTGT
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations