Transcript

bmp7a-201

ID
ZDB-TSCRIPT-090929-17701
Name
bmp7a-201
Previous Names
  • bmp7a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037275 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037275|OTTDARG00000027635|ZDB-GENE-000208-25 bmp7a|OTTDARP00000029871 bmp7a-001 LG_none CR925817.13,CU633826.8 Danio rerio protein_coding KNOWN, 3384 bp
GAGACCGTCAGTTCAACCTCAGATCATCCTGGATGTTGCT
CTGGATTGGATTAATCAACACGTGTATGGCATTCAATACA
GACTCAACTTCATGTTATGCTCAAACGAAATAATAACAAT
ACTTCACTAATCGATTGTGGACTTCTGCTTAACTCTTGTT
ATTTTTTTTAAGAATATATGACTCTAAAAATGTTTCCAGT
GCATCTTATTTCCACTTTGATAGTGGCTTGTGGTTGCAGT
GTGCTCGCAGACGCAATGCAAGCAAACTTCACCATGGATA
ATGACATTCAGTCCAGCTTCATCCAGCGGCGCCTGAAGAG
CCAGGAGCGCAGAGAGATGCAGCGGGAAATCCTCTCTATC
CTCGGGCTGCCGCAACGGCCACGTCCGCTCCTGCACGAGA
GACACACCGCGGCTCCCATGTACATGCTGGATCTGTATAA
CGCCATCCTGGAGGACGGAGACAGGCGCGGTGGGCTTGTG
TACTCTTATGAACCCGCGTACACGACCCCGGGACCCCCGC
TGGTGACCCAGCAGGACAGTCGCTTTCTCAGTGATGCCGA
CATGGTGATGAGCTTTGCGAATACAGTGGATCCAGAAGAA
GACCTTCAACTGTATCATCAGCATCGCAGAGAGTTCAGAT
TTGACCTTTCTCGCATCCCGCCAGGTGAAACTGTGACCGC
TGCAGAGTTCCGAATCTACAAAGACTTTGTTCGCGAGCGT
TATGAAAACGAGACCTTCCATGTCAGCGTGTTCCAGGTGC
TTCAACAGCAGCACAGAAGGGAGCTGTACCTGCTGGACTC
ACGAGTGGTATGGGCTGCAGAAGAGGGATGGCTGGTCTTT
GACCTCACGGTCACCAGTAACCACTGGGTTATAAACCCAG
GTCAGAACTTAGGACTGCAGCTCTTAGTGGAGACCTCACA
TGGTGCAAGAATGAACCCAAGAAGAGCTGGCCTGGTGGGC
AGCAGTGGAGCTCAGAATAAGCAGCCGTTTATGGTGGCGT
TTTTGAAAGCATCAGGAATCCACCTCCGCAGTGTCCGCTC
GGCATCAGGAGGCAAACAGAAGGGTCATCACCGCACAAAA
AACGCCAAACCTGGCGCTGCACACAGCCAGGTGGCTTTAA
AAACAGCTGAAGCCACAGAGGGTGCCAGCATAGATCCCAA
ACAGGGCTGCAAAAAGCATGAACTCTACGTCAGCTTCAGA
GATCTGGGATGGCAGGACTGGATCATCGCCCCAGAGGGTT
ATGCCGCGTACTACTGTGAGGGCGAATGTGTGTTCCCTTT
GAACTCTTATATGAACGCCACAAACCATGCTATTGTACAG
ACACTGGTTCATTTCATAAACCCTGAAACTGTCCCGAAGC
CCTGCTGCGCTCCAACTCAGCTGCACGGAATCTCAGTTTT
GTACTTCGATGACAGCTCCAACGTAATATTGAAAAAGTAC
CGCAACATGGTCGTCAGAGCCTGCGGATGCCACTAATCAC
TACCTCTACCCTCACCAGAGGGATTCAACAAGGGATTTAA
AGACTTGTATTCTTGATTATCAAGAGCGCAGAGAGAATAC
GAGACTCGCTGCTGGACCCAAACTGGACTTCTTCATATGA
AGCGGATAAGACAAAACTCAAAACTCCTAGAACACAGCTG
AGTGTGTGTTGTGTCTGGCTTTCATTTCTGCACAGAGAGC
CAAGTTTAAAATATCAAAAAGGACATAAGCAGATACAGAG
AGAAAATAAAAGAGATTTAACCAGACTGATCAGGGAAGAT
GCAGTGGATTTAAGCATAATGCTATCGTATTTCATAAACC
ACTTGACTTGATTTCTGAAAGAATAATACCTTTTAAAAAG
TCTGAGACCACTAGTTGAAATGTTTTTGTTTTGGAAAGAA
AGCTGCAGGCTTCATGCACTCAAGAACAATGTAGTCCAAG
CTCTGTTTATGTACACTCACTGGCCACTTTATTAGGTACA
CCTTACTAGAACCCGGTTGGACCACCTTTTGCCTTCAGAA
CTGCCTTAATTTTTTTGGCATAGATTCAATAAGATACTGG
AAATATTCTTTAAAGATTTTGCTCCATGTTGACATGATAG
CATCACGCAGTTGCTGCTGATTTGTTGGCTGCACATCCAT
GATGCGAATCTCCCGTTCCACCACACCCCAAAGGTGCTCT
ATTGGATTGAGCTATGGTGACTGTGGAGGCCATTTGAGTA
CAGTGAACTCGTTGTCATGTTCAAGGAACCAGTCTGAGAT
GGTTCACACTTTATGATATGGCGTGTTATCCTGCTGGAAG
TAGCCATCAGAAGATGGGTACACTGTGGTCATAAAGAGAT
GGACATGGTCAGCAACAATACTCGGGTAGGCTCTAGTGTT
GTCACAATGCTCAATTGGTACTAATGTGCCCAAAGTGTGC
CAAGAAAAAATCCCCCACATCATTACACCACCATCACCAG
CCTGAACCATTGATTCAAGGCAGGATGGATCCATGCTTTC
ATGTTGTTGACGCCAAATTATTTGCTGATGTAGCCCATCC
GCTTCAAAGTGTTTTAAGTGTTTAGAGATGCTCTTCTGCA
TGTCTCTGTTGTAACGAGTTGTTATTTGGGTTCAGCTCAA
ACCAGTCTGGCCATTCACCTCTGATCTCTGGCATCAACAA
GGCATTTGCGCCCACAGACCTGCCACTCACTGGATATTTT
CTCTTTTTCAGACCATTCTCTGTAAACCCTAGAGATGGTT
GTGCATGAAAATCAAAGTAAATCAGCAGTTTCTGAAATAC
TCCGACCAGCCCGTCTGGCACAAACAACCATGCTACATTC
AAAGTCTCTTAAATCCCCTTTTTTCCCCATTCTGATGCTC
GGTTTGAACTGCAGCAGATCCTCTTGACCATGTCTACATG
CCTAAATGCATTGGACAGGTGTACCTAATAAAGTGGCCGG
TAAGTGTATATGGCCAAGTTATACATATATATGTCTTCTA
TTCTTTAGACTGTACTAGATGCAAGATAAAAACCTAAATT
ATGGTTGTCCGTTGTGATTGTTTTCAATTTCACTCTTTCT
GGACACTCGGCAAATCCCCTCACAGATGTTCAGCACTCGA
TTTAACATTATTGCAGAACATATGAAGCCCAGCTCTGTCC
TGGCGTCACTTTGGTTTCATCACACAGTACATGAAAGAAC
ACATGTTTTCTCTCAGCAGTTATCAGTCAATCTAGTCAAT
AGAAAGATGGCCTTTCAGGGGTTCAGAAGAGTCCAGCTCA
TTGTTTGGGAGAAGCTTCATTGCTGATGGATTTAGTGTGG
AAATGTCAGTCACTAATAACTGATAATTCTGTTCCTATAT
TATGCAAGATTTCTGTAAATATGTGCATATGTATATACGA
ATTGCATAAACTTTTATTGATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations