Transcript

ccdc151-201

ID
ZDB-TSCRIPT-090929-17056
Name
ccdc151-201
Previous Names
  • ccdc151-001
  • zgc:152917-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036593 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036593|OTTDARG00000027268|ZDB-GENE-061013-787 ccdc151|OTTDARP00000029353 CH211-276A17.4-001 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 1846 bp
TTGCTTGGCAACCAGTTAAAGACGCACAGGATACGGTTGT
TGCTCGGCTGTAGAGGAGACGAAAATTCAACTTTAAACCT
CAACATATTCATATATAATGCCCGGCACGTCGGTCTCTGG
TGGCCTTATGGTCCCTATTCATGATAAAATTTCGGAGCTC
CAAAGAAAAATCCAACTTCTTGAGGGAGACAGAAGCGCGT
ATTTCGAAAGCTCTCAGTCTGCCATTAAGAAGAACAGAGA
GAGCATCCTACAGCTGAGACAAGAAAACAAAAACCTGCAC
AAGAAACTGGCTGAGAGCGATGAACAAGTTATCAAGGATG
TTTTTCAAGGCTATGGTGTGGAGAAAGCACCATTCAGGAA
CATGCCTGTGAAGGCAGCTCGTACAGTGCTGGAGAAGCAG
GTGCGTGATAAAATGAAGAAGTTGAATGCTATGAAACACA
CCACTCAGAAACAGAGGCAGCGTTTAGAGGACCTGAAGCT
GCAGTACCAGAGCATGAAGCCACACAACAAAAGCCCTCTG
CCTGACACCCAGAAACAGGAGGACGAGGAAAAGAAATTGC
GTATTCTTGAGAACCGTTTGGAGAAAACGCAGCTGAAATG
CCATGAAGCGGAGCACATAATGCGAGGATACCTGAAACTG
AAGGAACATCTGCAGGAAGAGAGTCTTACATTTCAGCCAC
AGCTAGACAGGATGGAGACAGAGATTCACAGACAGACACA
AGTGTTTAAAGACCTGCAGGTCATGAACAGTGACGCTCAT
CTGTCTAAGGATGCTGCCAAGGCTGAGCTGCAGCTTCAGG
AGGAGCAGGTGTACAGAGAGCGCAAAGAGAGAGAGAAAAT
CCTCTCCCGCTACAAAAAGCAGACGGTGGAGAGAATGAAT
CAGGCAGAGAGGATGAAGAGAAGACCTCAATGGGCCACCA
TGCACCCCGATGAGCTGAGCAGCGAGGCCCAGCGCAGCGC
CATCATAGTAGGAGAAGAAGCAGAAACCACATCTACGTTT
GAAGAAGCTTTCCAGCGCATCAAAGAAGCCACTGGAGTCA
CAGACTCACAGGAAATAGTGGACAGGTTTGTCTCTCAGGG
AGAAACTCATGGTCACTTGGAGAGGATGAAAGCAGAAAAT
GAGAGAATGCTGCAGGAACTGAAAGAAGAGAGAAACACAC
TACAGACTCAGCTTCAGGATATGAAATACTCACGAGAGAC
GGAACTCTCAAGCGCGGAGCAGATGCTGCAGGAGTGTGAG
CTTCGTCTACAGCAGGAGCAGCAGCGTCGTGATGCAGCTA
AAGATCATCTGGACAGACTCACACACATACTAAACACTGT
CAGAGCAGGAGTGCAGCAGCTCAGCGACAAACTACAGCAC
ATCCCACCGATGAAGGGTCCGGAACCCCAGCTGTCTCCAG
ACTCAGACGAGCACATACTGGAGCTGATGTCTGAGGCTGA
GGAGAAACTCATGCTGCTGAAAGAGGAACTGCAGGGCAAT
GATCTGGCAACCATCATGAAGGAGATGGAGGAGGAAGAGT
TCCATGCCACTATAGCGAGAAAAATACCCCAGTACAACAC
TCGCATTCAGCTGCATGAGGCCCACAAACAGGATCCTTTT
GACGATGAGGAGGACAGCGGCGATGATGAGGGCGATATCA
TCACCCGATTCAGCCTGAAGCATCAGTCGCAGGCAATCAT
TGACGCAAATACCAAGAGGAAGACTCGCATCAAAAAGAGG
AAGGGTAAACTCTGATCTGATCCAGCCCCATGATGAGGGT
TCGTCAGCATCTGATCCACTTTAAAACATAATCATTCTAG
AATTCTGGACATTCATGCTTAAGAAAAATAAAGAGATTGA
ACATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations