Transcript

hspa8-202

ID
ZDB-TSCRIPT-090929-1557
Name
hspa8-202
Previous Names
  • hspa8-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009645 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009645|OTTDARG00000008420|ZDB-GENE-990415-92 hspa8|OTTDARP00000008310 hspa8-002 LG_ BX120005.6 Danio rerio protein_coding KNOWN, 675 bp
CCAACCGGCATCTTCATCCATCTCTGTTTTATCAAGCTTG
TTTGACCGTAGAACGTTCTAGAAGCGCACACCACGTGGTC
TGACGCACATCCGCATATGCTCCAGGACACAATGTCCAAG
GGACCAGCTGTTGGTATTGATCTCGGGACCACCTACTCCT
GTGTAGGTGTCTTCCAACATGGAAAAGTTGAAATTATCGC
TAATGACCAAGGAAACAGGACCACACCAAGTTATGTAGCT
TTCACAGATACTGAGAGATTGATTGGAGATGCCGCGAAAA
ATCAGGTGGCCATGAACCCCACCAACACAGTCTTTGATGC
CAAGCGTCTGATTGGCCGCAGGTTCGATGATGGCGTTGTT
CAGTCTGATATGAAGCACTGGCCTTTTAATGTCATCAATG
ACAATTCCCGTCCCAAGGTCCAGGTTGAATACAAGGGTGA
ATCCAAGTCCTTCTACCCTGAAGAAATTTCCTCTATGGTC
CTCACCAAGATGAAGGAAATTGCTGAGGCCTACCTGGGAA
AGACTGTTTCCAACGCTGTGATCACTGTGCCTGCGTACTT
CAACGACTCTCAAAGACAGGCCACCAAGGATGCTGGTACC
ATCTCTGGCTTGAATGTTCTGCGTATCATCAATGAACCAA
CTGCTGCTGCTATTGCTTATGGTTTGGACAAAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations