Transcript

nr1h5-002

ID
ZDB-TSCRIPT-090929-15556
Name
nr1h5-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034858 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034858|OTTDARG00000026295|ZDB-GENE-080403-3 nr1h5|no_translation nr1h5-002 LG_ BX321886.14 Danio rerio protein_coding KNOWN, 810 bp
ATCCGGGCCATCTCTGTGAAGAGTAAGAATCCAGTGATCA
GATGAGAGAAGGGACAGATCCTGAGATGAGCATGTCTGTC
AGCGGCTATCTCTCTGCCTCAGACGCCTTTGACATCACAG
ACCATTCACAGTACTATGATGTTCTTGTGGATCCTCTGAG
CTGCTCTTACCAGGAACCGGATCTACAAAGCCCTCTCTAT
GGCCAACAACCATTTAGTCCTGTCAACGTGCAGTTCTCCA
TGTATGGGGCGCAGAATGTTCCAGCATGCAACCCGCCGTA
CCCCTACAGCCATCAGTGCTCTGAATACACCTGTGAGCCT
GATATGGAGGTCCAAAGCTCAACAGCCAGAGCCAGCATTG
TTGGTCTTCCAGTGCTGAAAAGACCCAGAATGGGCCATGG
AGCTCGAGTGAAGGGCCAGGATGAGCTGTGTGTGGTGTGT
GGAGATAAAGCCTCAGGATATCACTACAATGCCCTCACCT
GTGAGGGATGCAAAGGTTGGACGCTAACAAAACACTAGTG
CTGAGTTTTAGGACAACATGAATGCATGATGCACTTCTTG
AGAAGAAGTAAAACATAGTATTTAGGAAGACCAGCATGGA
TTTCCCTTTTACATAAGCAGGAGGTTGGATAGATTCATTC
ATTCATTGTCCTTCAGCTTAGTCCCTTTATTCATCAGGTG
TCGCTACAACGGAATAAATCGATAACTTATCCAGCATATG
TTTATGCAGCGGATGCCCTTCCAGCTGCAACCTAGTACTG
GGAAAAACCCATACAAACTCATTCACACACACACACACAC
ACACACACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations