Transcript

nr2f6a-201

ID
ZDB-TSCRIPT-090929-13609
Name
nr2f6a-201
Previous Names
  • nr2f6a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032035 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032035|OTTDARG00000024470|ZDB-GENE-030131-4362 nr2f6a|OTTDARP00000026007 nr2f6a-001 LG_ CR384062.10 Danio rerio protein_coding KNOWN, 2912 bp
ACACACACACGCGCTCGCTCACAGGCACGCGGCGCGCGCA
CTCTACTGGACACTGGCTCGCGCTCTCTTGTCCTCCTCAA
GCCCGCGCGACTCTGCCACTTCTTAAAACAGGTCCTTATT
TGGAAATAAACTTCCAAACTCATTACCCTTGGTGTGACTA
AAGAAGCGGATCCAAAGAATGAATATGATCAGTCAAGGAG
GCAAAGCAACATGTACAGCCCGCTGGCTAAAGAAGAAAGT
TAACTGACACAGACACACACAAGTGACTCAGAACTCGTGT
CTGAGCCTAAATGTGTCAGACGAAGCTGCGGACAATTACC
AGATCCAGAGGCCTTCATATCTTCTCATTTTAGAACACGC
AGCTGTCAAAAAAAGGGGTCAAGTGAAACTGTCTGTGCCG
ACAGCACGTTTGGGAGTATCATTCTTCCTCGGTTGTGCTG
AGAACTAAGCGATGGCCATGGTGAGAGGGGGGTGGGGAGA
TCCCAACGGGGAAACAAATGGACTTGGTGACAAGGGTTAC
CTGAGGGGAGATGAAGATGACGGGTCACCGCAAGGAGGCG
GCAGCGACATGGAGGCCGGTGAGGATGATAAGGGATGTGT
GGTGGACTGTGTTGTCTGCGGCGACAAGTCCAGCGGGAAA
CACTATGGTGTGTTCACCTGTGAGGGCTGCAAGAGCTTCT
TTAAACGAAGTGTCAGACGAAACCTTAACTACACCTGCAG
ATCAAACCGAGACTGCCAAATTGACCAGCATCATCGCAAC
CAGTGTCAATACTGCCGTTTAAAGAAGTGTTTCCGAGTGG
GAATGCGTAAAGAAGCAGTTCAGCGTGGACGGATCCCACC
TTCACATTCGAGCCTGAGCCCATCTACAACTCCAGTAGGC
GGTAATGCCGGCGGTGGTGTGAGCGAGTTCTACAATGGGC
AGCCGGTGTCCGAGCTCATCTCCCAGCTCCTGCGGGCAGA
GCCTTACCCTAACAGCCGCTACAGCCACCAGTACAACCAG
CAGATGCAAGGCGGTGGTGGCGGTGGATCTGGCATGGGCA
TCGACAGCATCTGTGAGCTCGCTGCCAGACTCCTGTTTAG
CATCATCGAATGGGCCCGAAACATTCCGTACTTCCCCGAA
TTGCCAGTATCGGAGCAGGTGGCCTTGCTGCGGCTCAGCT
GGAGCGAACTGTTTATTCTGAACGCAGCTCAATCTGCCCT
GCCACTGCACATGGCCCCGCTGCTGGCCGCCGCAGGCTTC
CACTCCTCACCCATGTCCGCGGAAAGGGTGGTGTCCTTCA
TGGACCAGGTGCGCGTCTTCCAGGACCAGGTGGAGAAGCT
GACGCGTCTGCAGGTGGATTCGGCAGAGTACAGCTGTCTC
AAGGCCATAGCGCTCTTCTCGCCAGATGCGTGTGGGCTGA
CAGATCCCGCTCATGTAGAAAGCCTGCAGGAGAAAGCTCA
GGTGGCTCTTACCGAGTACGAGCGCATGCAGTACCCCGGG
CAGCCCCAGCGTTTCGGACGGCTCCTGCTGCGACTGCCCG
CTCTGAGGGCCGTGCCCGCCAGCCTCATCTCTCAGCTCTT
CTTCATGCGGCTCGTGGGCAAAACGCCCATCGAGACACTC
ATCCGTGACATGCAGCTGTCTGGCAGCTCCATCAGTTGGC
CGTATGCTCCTGGACAATAATCTTCATCACATGTGACCAG
CCTGAACGGGAAGATCTTGGTCTGACTTGTTTTGTTTTTT
TATATCCACACATTTACATCTGATATTCAGTGTATTGCCT
AATGCAACAGGGTCGCACTATGGAAATGGTGAATTGGGTA
TTATGTTGCAGATCGGTGAACTTCAACATGACTTGAAGTA
TTTGTTATCTGCCAACCAAAGGTAAGACGTGAGGTACCAT
TTTTTAAAGATTGTAATTAATTGGAAATGGGTTCAAACCC
TAAAAGGCGAGATCTGACAGTTTGGTGTCAACAACACGAA
GGTCACTTTGGACTGTTCCCGGAGGCCTGGGAAATCAAGT
TCCCATCATGCTCCGCTCTGCCCTGTCCTTGTGCACCACA
AAGCCTGAAGGAGGAGGAAGTAGACACGATGACATCCAAA
CAAACCAAACCCAAACAGTCTGAATTAGGACTAAGGCATT
TGTTATGCCAACGAGAACTTGTATTTTTTAGCTCTTTTTA
CCCTTGTCAAAGCTAACGCATTTCTGAGGAGAGAGTGAAA
TTTGCAACTGATTATGTTGAATTAAGTATAGCTGCGGACT
TTATTTGTACTTTGAGTTAAGGTACAGGCTCATCTCATCA
AGAATGATTCATATTTTGGAGCGCACACCCTTCATTTGAG
ATAGATGACAGGTGAAGTAGTCTTGTTTTTTTCTTTTCAG
ACAGACACCAATGAATTTTCTTCTTAAAAAGGTTTCTTTT
TTTTTTTTTTTTTTTTAGTTTTTTCAGACTTCCACTGGTA
ATGAAGTCCTATTATGAACGTCGACCAAAAGAAATACCTC
TACAGTCTGTTGAGACTCTGTGTCATTCACGGCTGTGTCA
GATTTTCTATGTACCAACATACTTGAGCTGCTCACTTTAC
ACTAAAGAGGAGTGATTGGATCAATCTGTCTGTTATGTTT
GTTTCTCGAAGGCCGTTTTCAGCAGGAAACCGGCTGTGGC
TGTTTTGTCTTTCGTGGAGCATTGCTCTGGTGTGGCGTTT
CACAGGTGACAGCATGTTGTATTGGCTCTTGTTGTGAGAT
GTCCGTTTTCTAGCCTTATCATACATCAGAATGACTAATA
TTACCTCATATTTAGGCCTTTAAAACATATCAGACGGTCT
AATAGACATCAATGCATCAAATCGGCAACGTGTACAGTTT
TCATTTTAATATCTTTGTCTTTTTAAATACTTGTGTATGA
CGGCTTGATTAAACAAAGTATCATACAACGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations