Transcript

nr1d4a-201

ID
ZDB-TSCRIPT-090929-12419
Name
nr1d4a-201
Previous Names
  • nr1d4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030161 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030161|OTTDARG00000023190|ZDB-GENE-080403-5 nr1d4a|OTTDARP00000024572 DKEY-18F23.6-001 LG_ BX465853.12 Danio rerio protein_coding NOVEL, 1986 bp
ATACTAGAATCAAGAGCAGAAAGAACAGGTAGCTGCGCGC
GGAAGGTGCATCTGCACACCTGTGAACGACTCGATATTTA
CTCCCGACTGTTTGGCTGCGCTGCCAAATGTTCTCAGCGA
GAGACTCTGCCTGCCTACTTTGGGCTGTTCACTGTATTCA
CAGGCAATGCGTGGCTTTTTAAACTGATTTACCTGAATTG
ATCACACTGACATTCACAGACCATCTTGAAGATACGAATT
CTGAAGATAGAGGCGTTTGAAAACATATCAAGGATGGATA
GCAGTCCTGGGAGCGTGATTCTCTACGCTGGTTCCAGTGG
CAGTTCCAGTCCAAGTCCAGGAAGCCCTTCAAGTGGTTAT
CAAACCCAGTCTCCATCCTCTCACTCCCAGCCTTCTTCCC
CAGAGGAGGTGACCTTCACCGAGATCGGGGCCTTCAAGCA
GCAGGGAAATGCTGGATCACCAAATTCTCCAAAACTGGTC
TTTCAGTTCCCTGAAATCTACAACAACTCCACAGCAGGTC
CAAACCCGCACAGCTACTCCCACCCTATCGCCGGTAAAAG
GCCTTGTGGATTCACTGGCACATTTACCAAGACGGGAGGC
ATGGTGCTCCTTTGTAAAGTATGTGGAGATATTGCATCAG
GGTTCCACTATGGTGTCCATGCATGTGAAGGCTGCAAGGG
CTTTTTCCGCCGCAGCATTCAGCAGAACATCAACTACAAG
ATGTGCGTGAAGAACGAGAACTGCCTGATAATGCGCATGA
ACCGCAACCGCTGCCAACACTGCCGCTTCAAAAAATGCCT
GTCCGTTGGCATGTCCCGTGACGCTGTGCGTTTCGGCCGC
ATCCCTAAACGTGAGAAGCAGCGTCTTCTGGATGAGATGC
AGAGCTACATGAACAGCCTCAACGAATCCTCCATGGGCAT
GGAAACCTCCCCACAACATGAACCACCACCCAGCCCGATT
GAGAACCAATCCAAAGAGGCCATCGGTGCCTTATCCCGAG
CCTACCAGGACATCTTCACCAACACACAGGACCACTTGAA
CAAGCGTGCAGGGAACAACAACATCAGCAGATCGAGCAGC
TATCAAAACAGCCCTTCTCAGGACAGCAACTATCCTCATG
CCAACCCTCTTGCTGGGTATCACACGACCACTCACGAAAG
CTTCTCAGGCCCGGTTCGCTGTCCAGTTTCCACCAGTGAG
AGCAAATGCCCGGTGTCGTTAGTGGACAACAATCGGTACA
GCTATGCTCCTTCATTCAGCCAAAATCACTCCCAGTCCAG
TGTTAACCAGCCCTCACAACCCACTCAGGCCCATTACAGC
AGCTACACAGCCAGCCAATCCCAAAGCCCAGCCTCGTGTC
CGTTCAAGCTGGCTGCTGGCTCCAAAGTGCTGGCCTGTCC
ACTGAACGCCTGCCCTGTGTCAGCTCCTGGTGTTTCCAGT
CAGCAGGTGTGGGAGTCTTTCTCACAGTGCTTCACACCGG
CTGTACGTGAAGTGGTGGAGTTTGCGAAGGGCATTCCAGG
CTTCCAAGAGCTCTGCCAACACGATCAAGTCATGTTGCTC
AAAGCGGGCACTTTCCAGGTGCTTATGGTGAGGTTTTGCT
CACTGTTCAACCACAAGGAAAGATCTGTGACTTTCCTCAA
TGGGCAGACGTACCCGCTGGGCACCCTCAGGGGTCTGGGC
ATGGGCTCACTGCTGGACGCCATGTTTGAGTTCAGTTCCA
AGCTGAGCTCTCTGGGCCTGGAGTCAGATGAGATGGCTCT
CTTTATGGCTGTGGTGCTGGTTTCTGCAGATTGCTCTGGC
ATTTCGGATATGTTGGCGGTTGAACAGCTCCAGGAAGGAC
TCATCCGAGCTCTGCGCACTTTAATCAACCGTCGACACCC
CGACGACAACTCGCTCTTTTCTAAACTTCTCCTGCGCCTC
CCAGACCTGCGCACCCTCAACAACCTCCACTCCGACAAGC
TGCTGGCCTTCCGCATTGACCCATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations