Transcript

nr3c1-203

ID
ZDB-TSCRIPT-090929-11398
Name
nr3c1-203
Previous Names
  • nr3c1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028964 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028964|OTTDARG00000022489|ZDB-GENE-050522-503 nr3c1|OTTDARP00000023687 nr3c1-002 LG_ BX470157.7 Danio rerio protein_coding KNOWN, 1720 bp
TAATGCAAAATGGATCAAGGAGGACTGGAGAATGGCAAAA
AGCGAGATGAGCGTTTAAATACATTGGATTACAACAAACG
AGCAACTGAGGGGATATTACCAAGAAGAATACAAAGCACC
ATGTCTGTGGCCCCTACATCTATGGTTCCTCAAGCCGGTC
CAATGATGCAGCCAGTTTCTGGGGACATTCCCAATGGCCT
GAGCAATTCGCCCACTCTGGAGGAGCACACCAGCTCGGTG
TCCTCCATCTTTGGCGACGATTCCGAACTCAAACTGCTTG
GGAAGGAGCAGAGGGCCCTGCAACAGCAGACCTTGGTCCC
CTTCACTTTGGGTGACAGTCTTTCAGGTCTGGAGGCCAGC
ATTGCAGACCTTAACAACCCCTCTCCCTCAATGGATTCCC
TGATTGGTGGAGTCGATCCCAATCTTTTCCCCTTAAAAAC
AGAGGACTTTTCTCCCATGATTAAAGGCGATATGGACCTT
GACCAAGATTCCTTTGGACACATTGGGAAAGATGTTGATG
TTGGCAATCATAAGCTCTTTAGTGACAACACTCTGGACCT
CCTGCAGGACTTTGAGCTGGATGGATCGCCATCAGACTTC
TACGTTGCTGACGATGCGTTTCTCTCCACCATAGGTGAAG
ATGCTCTCCTTTCAGAGCTGCCGACAAATTTAGACAGGGA
CTCGAAGGCTGCGGTTTCCGGGAGCAACACGCTCAATGGC
ACAGCTTCTTCCAGCCTCAGCACAGCCAACACCAGCATCT
TGCCCAATATAAAGGTGGAGAAAGACTCTATAATCCAGCT
GTGCACCCCAGGGGTCATCAAACAGGAGAACACCGGTGCG
AGCTATTGTCAAGGAGGGCTCCACAGCACCCCCATTAACA
TATGCGGGGTCACCACTTCAAGCGGACAGAGCTTCCTCTT
TGGGAACAGCTCGCCCACAGCTGTCGTCGGTCTGCAGAAA
GATCAGAAGCCGGACTTTAACATGTACACCCCTCTGACCT
CTTCAGGAGATGGTTGGAGCAGGAGCCAGGGCTTTGGGAA
TGTCAGTGGAATGCAGCAGAGGGCCAGTTTATGCTTTTCC
AAAAACTTCTCAAGCAGCCCCTATTCCAGGCCTGAAGACA
GCACTGCCACATCGTCAGCTGGTGGAAAGACTGGCACACA
CAAGATCTGTCTGGTTTGCTCAGATGAGGCTTCTGGCTGC
CATTATGGAGTTCTCACTTGCGGAAGCTGTAAAGTCTTCT
TTAAAAGGGCTGTTGAAGGGCAACACAATTACCTGTGTGC
TGGGCGAAACGATTGCATCATTGACAAAATCCGCCGGAAG
AACTGCCCTGCCTGTCGTTTCCGCAAATGCCTCATGGCAG
GCATGAACCTAGAGGGTAACATGAAATCTTGCATTTATTA
TATAATTATACCAGTGTGTCCTTAAATGTCAGTTTAGATA
TTAGAGCTGCATAAATGTGGATAAACTGAGAATCACATTT
TTTATAACTTTATTTATAGAACTTTTTGTGAAAACATAAC
ACTCAGTAATGTTCAACATGCATATTTGTTAACAAAGGTT
ATCAGTGTTACTAACTTATCCCAATTCCCCCCTCCCCCAC
CCCTAGTTTTTCGTGTTATTTTTTTGTGATTTTGTGGTGG
TAATTCCCTAAAATTCACAAAACAAAAATTTTGGGATTAA
AAGTATACATCTATATAAAAAAAAAAAAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations