Transcript

zgc:111976-201

ID
ZDB-TSCRIPT-090929-11277
Name
zgc:111976-201
Previous Names
  • zgc:111976-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028835 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028835|OTTDARG00000022406|ZDB-GENE-050522-332 zgc:111976|OTTDARP00000023583 DKEY-192L18.3-001 LG_ BX005461.9 Danio rerio protein_coding KNOWN, 1975 bp
CTCCCGCCTCCAGATTCTCGAGCGCGCCCGCTAATTAGAG
TCAATTAGAAGATAATTAGCCTCAGAAAAGTAGATATAAG
TTTGAATATTCATTTTCATTTGGTTATCTCGAAGTGATGA
GTTCTTAATCTTCTGACATAAGTCTAGAACAGCAGTCTGA
ACGTATTTAAGAAAACAAAATGGAGTTCAAGAGCGAGCGC
GGTCCTGTATGCATGAAGACCAAAACTTTAATGTCTGAAT
TAAAGTCCAAATATGCTGAGAAATCTTGGAATGAGTCATT
CCAGCTGGTACGGAGATGTATGGAAAAAACACGAGACGGC
AGAGTTTGTGAACCAATCGCAAAATGTCTGCAGAAGATCA
ACGAGGCGCTCAACGTGTCGTCCTCCGCAGCAATGGTGTC
CAGACTAGAGATGATCGCCAAACAAAGAGGCTTGGGGTCC
CACCTGAGCCCCACAGAGACGGTGTGTTACCTGACCGCAG
ACCTGTTTTATATCGAGGTGCTGCTGCTGCCGGGAGGACG
AGTGGAGGATGTGAGGGTTGCTCATCACGGGGAAGCTCCT
GTATCCAGCCCGTCACTCCTGCAGCTGTTAAGGATGAAAC
AATTTGAAGAGTTCTCCCTAAAGTTGGATGATCTTGCCTC
ATTTTACAACATCCCAGGAGACAGTGATGTGAAGATTAAA
GTCTACAGCTCTCTTCGGCACCTGGAAACTGACCTCTTCA
AAATATCCCATTTGCCAAGATCTCTGAGAGAAAGTGACCT
TCACATTGACCTCATTATGAACGGCAGGATTGGGAACGTG
CAGTCTGGCAGAGAGGGCTCACCAATGACCATCGAGTACT
ACATAAGTCCAGCAGATGCTCTCATGGGGCTGTCAAGCAC
CGGAGAGGTCAGCGCTGGCCGTGTAGCTCTGGTGACGGCG
GGCAGCACTGACTCCTCTCACAGACTGCAGATGGAGTCTC
TGATCTCCTCTCCTCCTCAGGTCGACTCTTGCGGGTTTCC
TGTGTTTCAGCCACTCACTGAGGCCTGTTCGCTGCTTCTC
CCTGCAACCTTTCTGCTCAAACTACAGCCGCCGTTACCTG
TGCTCACGTCCTTCATAGAGAAGATGGGCAAAATCACAGA
TGGTGTTATAGCAGAGAAACCCCTGCAGGTGGAGCCGCTG
CACAAACTACTCCTGAAGACCAGCAGAAAATACAACCCCA
ACACATCGTGCACAGACGGCCTGCAGTTTCTTGTGCCGCT
GCCTGGCTCTGAGTGCCACAGTTATGTGTTCCCCGGGGCC
CAATGGAGCTGCGAGAACTGGAACGGAGCCCTGATGGATG
CGGTGCCGTTCTCGCACCCGGGCCACGTCCCAGCTTTACT
GGAGATCCTCCGCCATCAGTCTGCCATCAGCGTCCTGCTG
GAGAGCTGCTTCAGCAAACACAGCCACAGCAGGGATGCAG
CTTTACTGTCTGAGCTGACATGTGAGCTGCTTCCAGAATC
AGACCACTGCTTTTCCATCACATTCAGCCTCCATGAGAGC
GAGCATCTGGCTGTTCTTCATGTGGCGGTGGTGGACTCTC
ATCAGATGAGCTGCAAACTCCTCATGCCTGATTTTATGGA
TCACGAGCTGGATGAGTACATATCCAGAGTCCTCATGCGA
TGCATGTCCATCCCCATCACAATGAGGGCTGTATGCAGGA
GAGTGGCCAGTCTGCGGACGCGTCCCGCACCAGTGTCAGA
CCCAGATGAGAGTGAGTGTGTCCCCGCTGCGGTTCAGGAG
GACATCAGCGTTTCTCTTACTCCTGATTTCTGTGATAAAG
CCAATACAGACGCGTTTGTTAACCCTTCCCCATGTGCCTC
TCTGGGTGTCTATTCACACTGGGCCACCGCTGGACTTCCA
GCAGAACTCGTGTAATCTCCTGCTTTTACTGTAGAGTTCA
CTTCATATCAGGGTTTTAGACTGAGGTTAAATAAAGGTAT
GTTATTTTAAAAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations