Transcript

mnd1-202

ID
ZDB-TSCRIPT-090929-10311
Name
mnd1-202
Previous Names
  • mnd1-001
  • zgc:101017-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027766 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027766|OTTDARG00000021735|ZDB-GENE-040801-116 mnd1|OTTDARP00000022730 CH211-208H7.1-001 LG_ BX088571.5 Danio rerio protein_coding KNOWN, 1005 bp
GCAGTGAGATTGTCTTTTTAGCTCTCGCGCCAAACTCAAG
CAGTCAAACATGTCTAAAAAGAAAGGACTTAGCTTGGAAG
AAAAAAGAAGTCGCATGATGGAAATATTTTTTGAAACTAA
AGATGTGTTTCAGCTGAAGGACATAGAGAAAATTGCCCCA
AAATCCAAAGGAATCACTCCCATGTCAGTGAAAGAGGTAT
TGCAGAGTCTGGTGGATGATAACATGGTGGACACTGAGAG
GGTGGGCACCTCCAACTATTACTGGGCGTTTCCTAGTAAA
GCACTGCATGCCCGAAAACGCAGGTTAGAGGAACTGGAGA
AACAACTTGAGGATGGCAGTCAGCGTAAAAAAGCCCTTCA
GCAAGCAGTTGACAAAGCCAAAGTGGGACGTGAAGTCAAT
GAGGAGAGAGAGGATCTCTTAAAGGAGCTCACAGCATTGA
AAGGTCAGCGAGATCAGATGAAGGTCGAAATAGAGAAGTA
CCAAGAATGTGATCCAGCGGTGGTGGAGGAAATTCGTAAT
GCCAACATTGCAGCTAAAGAGGCTGTGGCTAGGTGGACGG
ATAATGTTTTTGCAATCAAATCCTGGGCAAAGAGGAAGTT
TGGTTTCGAGAACAGTCGATTGGACAAAGCTTTTGGAATA
CCAGAGGACTTTGACTACATCAACTAACCAACAATTCACA
GCCTGATGGACCTTCTGATTGTGTTCAGCACTGCACAATC
AATAAGCTTTATTCTTTTGCATCAGTTTGTATCAGTTCTG
CATGTTCGAGACAAAGCTGTAAACAATTTTACACTGTTGT
GCATGGTGTAAATTCTAAGGAGTGCCCCACCCTTGAAATT
TTAACCTGGTCTAGTACAAGGCAAACTTCAAGATTGATTT
GTCAGCATAAAAGGGTAAACGATGGTGAAAACGCTCCTGG
TGTGTAAGTGGAGAAGGTGTTGTGTTAACCCTTGGCTACT
CAGAGACGCACTATATGCCCAGACTTACTCTTAGGCCACC
TGTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations