TALEN

TALEN1-tesmin

ID
ZDB-TALEN-220829-1
Name
TALEN1-tesmin
Previous Names
None
Target
Target Sequence 1
5' - ATTGGTGACAGAGTCTCATTGC - 3'
Target Sequence 2
5' - TGTCAGGAACAAACCGTCTTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3606 tesmin
Expression
Gene expression in Wild Types + TALEN1-tesmin
No data available
Phenotype
Phenotype resulting from TALEN1-tesmin
No data available
Phenotype of all Fish created by or utilizing TALEN1-tesmin
Phenotype Fish Conditions Figures
hypothalamus agrp expression increased amount, abnormal tesminzf3606/zf3606 (AB) control Fig. 4 from Zhao et al., 2022
hypothalamus agrp expression increased amount, abnormal tesminzf3606/zf3606 (AB) increased food availability Fig. 4 from Zhao et al., 2022
blood plasma insulin increased amount, abnormal tesminzf3606/zf3606 (AB) control Fig. 8 from Zhao et al., 2022
brain ghrh expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
liver glycogen decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
female organism increased length, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
liver ghrb expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
blood plasma glucose increased amount, abnormal tesminzf3606/zf3606 (AB) increased food availability Fig. 8 from Zhao et al., 2022
hypothalamus cart1 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) increased food availability Fig. 4 from Zhao et al., 2022
liver g6pc1a.1 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
liver igf2b expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
blood plasma glucose decreased amount, abnormal tesminzf3606/zf3606 (AB) control Fig. 8 from Zhao et al., 2022
adult feeding behavior decreased process quality, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 4 from Zhao et al., 2022
visceral fat increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 7 from Zhao et al., 2022
liver slc2a12 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
liver igf1 expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
liver lipid droplet increased distribution, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 7 from Zhao et al., 2022
female organism increased weight, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
liver fatty acid synthase activity increased process quality, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 6 from Zhao et al., 2022
blood plasma triglyceride increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 6 from Zhao et al., 2022
liver pck1 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
liver fasn expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 6 from Zhao et al., 2022
male organism increased weight, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
liver pfkla expression decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
hypothalamus cart1 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) control Fig. 4 from Zhao et al., 2022
periventricular nucleus agrp expression increased distribution, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 4 from Zhao et al., 2022
liver slc2a2 expression decreased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
liver triglyceride increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 6 from Zhao et al., 2022
liver glucose-6-phosphatase activity decreased process quality, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
liver gck expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 8 from Zhao et al., 2022
male organism increased length, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
hypophysis gh1 expression increased amount, abnormal tesminzf3606/zf3606 (AB) standard conditions Fig. 5 from Zhao et al., 2022
blood plasma insulin increased amount, abnormal tesminzf3606/zf3606 (AB) increased food availability Fig. 8 from Zhao et al., 2022
Citations