TALEN

TALEN1-capn3a

ID
ZDB-TALEN-190812-1
Name
TALEN1-capn3a
Previous Names
None
Target
Target Sequence 1
5' - GGCCAGGACTACACCCTCCT - 3'
Target Sequence 2
5' - CGAACAGGGTCTTCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju119 capn3a
Expression
Gene expression in Wild Types + TALEN1-capn3a
No data available
Phenotype
Phenotype resulting from TALEN1-capn3a
No data available
Phenotype of all Fish created by or utilizing TALEN1-capn3a
Phenotype Fish Conditions Figures
whole organism capn2a expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn1b expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn7 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn3a expression decreased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. 1 from Ma et al., 2019
whole organism capn8 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. 1Fig. 2Fig. 4 from Ma et al., 2019
whole organism si:ch211-202f3.4 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn12 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. 1Fig. 2Fig. 4 from Ma et al., 2019
whole organism capn5a expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn10 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn15 expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn1a expression increased amount, abnormal capn3azju119/zju119 (AB) standard conditions Fig. S1 from Ma et al., 2019
whole organism capn3a expression increased amount, abnormal capn3azju119/+ (AB) standard conditions Fig. 1 from Ma et al., 2019
whole organism capn3a expression decreased amount, abnormal capn3azju119/+ (AB) standard conditions Fig. 2 from Ma et al., 2019
liver decreased size, abnormal capn3azju119/zju119 + MO1-rbbp5 standard conditions Fig. 4 from Ma et al., 2019
whole organism capn8 expression decreased amount, abnormal capn3azju119/zju119 + MO1-rbbp5 standard conditions Fig. 4 from Ma et al., 2019
whole organism capn12 expression decreased amount, abnormal capn3azju119/zju119 + MO1-rbbp5 standard conditions Fig. 4 from Ma et al., 2019
whole organism capn12 expression decreased amount, abnormal capn3azju119/zju119 + MO2-setd1a standard conditions Fig. 4 from Ma et al., 2019
whole organism capn8 expression decreased amount, abnormal capn3azju119/zju119 + MO2-setd1a standard conditions Fig. 4 from Ma et al., 2019
liver decreased size, abnormal capn3azju119/zju119 + MO2-setd1a standard conditions Fig. 4 from Ma et al., 2019
whole organism capn8 expression decreased amount, abnormal capn3azju119/zju119 + MO3-ash2l standard conditions Fig. 4 from Ma et al., 2019
whole organism capn12 expression decreased amount, abnormal capn3azju119/zju119 + MO3-ash2l standard conditions Fig. 4 from Ma et al., 2019
whole organism capn12 expression increased amount, abnormal capn3azju119/zju119 ; upf1zju130/zju130 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn3a expression increased amount, abnormal capn3azju119/zju119 ; upf1zju130/zju130 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn8 expression increased amount, abnormal capn3azju119/zju119 ; upf1zju130/zju130 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn3a expression decreased amount, abnormal capn3azju119/zju119; upf3azju126/zju126 standard conditions Fig. 2 from Ma et al., 2019
liver decreased size, abnormal capn3azju119/zju119; upf3azju126/zju126 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn12 expression amount, ameliorated capn3azju119/zju119; upf3azju126/zju126 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn8 expression amount, ameliorated capn3azju119/zju119; upf3azju126/zju126 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn12 expression increased amount, abnormal capn3azju119/zju119; upf3bzju129/zju129 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn3a expression increased amount, abnormal capn3azju119/zju119; upf3bzju129/zju129 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn8 expression increased amount, abnormal capn3azju119/zju119; upf3bzju129/zju129 standard conditions Fig. 2 from Ma et al., 2019
whole organism capn12 expression decreased amount, abnormal capn3azju119/zju119; wdr5zju131/zju131 standard conditions Fig. 4 from Ma et al., 2019
whole organism capn8 expression decreased amount, abnormal capn3azju119/zju119; wdr5zju131/zju131 standard conditions Fig. 4 from Ma et al., 2019
liver absent, abnormal capn3azju119/zju119; wdr5zju131/zju131 standard conditions Fig. 4 from Ma et al., 2019
Citations