TALEN

TALEN1-il2rga

ID
ZDB-TALEN-160527-1
Name
TALEN1-il2rga
Previous Names
None
Target
Target Sequence 1
5' - TGGCAGTTTGGTGACGGAAC - 3'
Target Sequence 2
5' - TTCTCATACCATATTCTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mdu1 il2rga
mdu2 il2rga
mdu3 il2rga
mdu4 il2rga
Expression
Gene expression in Wild Types + TALEN1-il2rga
No data available
Phenotype
Phenotype resulting from TALEN1-il2rga
No data available
Phenotype of all Fish created by or utilizing TALEN1-il2rga
Citations