TALEN

TALEN2-tcf21

ID
ZDB-TALEN-160311-1
Name
TALEN2-tcf21
Previous Names
None
Target
Target Sequence 1
5' - TCTCCAGCCAACATGT - 3'
Target Sequence 2
5' - TCGTGAAATTCATCCACATCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sk1 tcf21
Expression
Gene expression in Wild Types + TALEN2-tcf21
No data available
Phenotype
Phenotype resulting from TALEN2-tcf21
No data available
Phenotype of all Fish created by or utilizing TALEN2-tcf21
Phenotype Fish Conditions Figures
intermandibularis hypoplastic, abnormal tcf21sk1/sk1 ; pd37Tg ; zf13Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
interhyoideus hypoplastic, abnormal tcf21sk1/sk1 ; pd37Tg ; zf13Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
head muscle aplastic/hypoplastic, abnormal tcf21sk1/sk1 ; pd37Tg ; zf13Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
pharyngeal musculature absent, abnormal tcf21sk1/sk1 ; pd37Tg ; zf13Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
hypobranchial artery DsRed2 expression absent, abnormal tcf21sk1/sk1; fb7Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
pharyngeal vasculature DsRed2 expression absent, abnormal tcf21sk1/sk1; fb7Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
cranial vasculature DsRed2 expression absent, abnormal tcf21sk1/sk1; fb7Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
aortic arch 6 blood vessel lumenization arrested, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 4 ZsYellow expression decreased amount, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 5 blood vessel lumenization decreased occurrence, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery shape, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 3 ZsYellow expression decreased amount, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 3 blood vessel lumenization decreased occurrence, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 6 ZsYellow expression decreased amount, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 4 blood vessel lumenization decreased occurrence, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 5 ZsYellow expression decreased amount, abnormal tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery shape, abnormal tcf21sk1/sk1; la116Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
pharyngeal vasculature DsRed2 expression absent, abnormal tcf21sk1/sk1; la116Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal tcf21sk1/sk1; la116Tg; pd37Tg standard conditions Fig. 4 with image from Nagelberg et al., 2015
aortic arch 6 blood vessel lumenization arrested, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
pharyngeal vasculature endothelial cell migration process quality, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 6 with image from Nagelberg et al., 2015
hypobranchial artery mCherry expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 5 blood vessel lumenization arrested, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 3 ZsYellow expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 4 ZsYellow expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 5 ZsYellow expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 6 ZsYellow expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
aortic arch 4 blood vessel lumenization decreased occurrence, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
hypobranchial artery ZsYellow expression absent, abnormal nkx2.5vu179/vu179; tcf21sk1/sk1; fb7Tg; s896Tg standard conditions Fig. 5 with image from Nagelberg et al., 2015
Citations