TALEN

TALEN2-foxc1a

ID
ZDB-TALEN-150624-2
Name
TALEN2-foxc1a
Previous Names
None
Target
Target Sequence 1
5' - CTCACGCGGCCCACGACCAGT - 3'
Target Sequence 2
5' - GTATGGCCCATATGCCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nju19 foxc1a
Expression
Gene expression in Wild Types + TALEN2-foxc1a
No data available
Phenotype
Phenotype resulting from TALEN2-foxc1a
No data available
Phenotype of all Fish created by or utilizing TALEN2-foxc1a
Phenotype Fish Conditions Figures
bulbus arteriosus shortened, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
presumptive cardiac ventricle heart tube decreased size, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrioventricular canal tbx2b expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
heart contraction disrupted, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
cardiac ventricle decreased size, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
whole organism tal1 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
heart edematous, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Li et al., 2015
cardiac ventricle vcana expression spatial pattern, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrium increased size, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
presumptive atrium heart tube myh6 expression increased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
pericardium edematous, abnormal foxc1anju19/nju19 standard conditions Fig. 1Fig. S1 from Yue et al., 2017
blood hbae1.1 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. S3 from Yue et al., 2017
whole organism etsrp expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
atrioventricular canal nppa expression spatial pattern, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
somitogenesis process quality, abnormal foxc1anju19/nju19 standard conditions Fig. 2Fig. 3 from Li et al., 2015
somite decreased size, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Li et al., 2015
eye decreased size, abnormal foxc1anju19/nju19 standard conditions Fig. S1 from Yue et al., 2017
presumptive atrium heart tube myh6 expression increased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrium myh6 expression increased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrioventricular canal nppa expression increased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrioventricular canal bmp4 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
cardiac ventricle myh7 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
lateral plate mesoderm etsrp expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
atrioventricular canal endothelial cell mislocalised, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
lateral plate mesoderm nkx2-5 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
presumptive atrium heart tube increased size, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
atrioventricular valve morphology, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
cardiac ventricle myh7 expression decreased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
pericardium decreased thickness, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
cardiac ventricle vcana expression increased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
heart contraction decreased occurrence, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
blood hbae1.1 expression decreased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. S3 from Yue et al., 2017
lateral plate mesoderm tal1 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
whole organism nkx2-5 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 3 from Yue et al., 2017
whole organism decreased length, abnormal foxc1anju19/nju19 standard conditions Fig. S1 from Yue et al., 2017
Fig. 2 from Li et al., 2015
presumptive cardiac ventricle heart tube myh7 expression decreased distribution, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
myocardium decreased thickness, abnormal foxc1anju19/nju19 standard conditions Fig. 1 from Yue et al., 2017
atrium myh6 expression increased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
erythrocyte development disrupted, abnormal foxc1anju19/nju19 standard conditions Fig. S3 from Yue et al., 2017
presumptive cardiac ventricle heart tube myh7 expression decreased amount, abnormal foxc1anju19/nju19 standard conditions Fig. 2 from Yue et al., 2017
blood hbae1.1 expression spatial pattern, abnormal foxc1anju19/nju19 standard conditions Fig. S3 from Yue et al., 2017
atrium increased size, abnormal foxc1anju19/nju19; s843Tg standard conditions Fig. 2 from Yue et al., 2017
cardiac ventricle decreased size, abnormal foxc1anju19/nju19; s843Tg standard conditions Fig. 2 from Yue et al., 2017
Citations