Morpholino

MO1-clcn3

ID

ZDB-MRPHLNO-260915-1

Name

MO1-clcn3

Previous Names

None

Target

clcn3 (1)

Sequence

5' - CACCCTCTGCGATGCCTCGAAACGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-clcn3

No data available

Phenotype

Phenotype resulting from MO1-clcn3

Phenotype	Fish	Figures
ceratobranchial 5 tooth anatomical surface rough, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
ceratohyal cartilage decreased length, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
head decreased length, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
head decreased width, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
Meckel's cartilage increased distance ceratohyal cartilage, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
palatoquadrate cartilage decreased length, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
tooth row tooth mineralization decreased occurrence, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026
whole organism decreased length, abnormal	AB + MO1-clcn3	Figure 4 from Zhang et al., 2026

Phenotype of all Fish created by or utilizing MO1-clcn3

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage decreased length, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
ceratobranchial 5 tooth anatomical surface rough, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
palatoquadrate cartilage decreased length, abnormal	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
whole organism decreased length, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
Meckel's cartilage increased distance ceratohyal cartilage, abnormal	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
ceratobranchial 5 tooth anatomical surface rough, exacerbated	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
ceratohyal cartilage decreased length, ameliorated	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
head decreased length, abnormal	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
head decreased width, ameliorated	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
whole organism decreased length, ameliorated	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
Meckel's cartilage increased distance ceratohyal cartilage, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
tooth row tooth mineralization decreased occurrence, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
palatoquadrate cartilage decreased length, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
head decreased length, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026
tooth row tooth mineralization decreased occurrence, exacerbated	AB + MO1-clcn3	chemical treatment by environment: sodium fluoride	Figure 4 from Zhang et al., 2026
head decreased width, abnormal	AB + MO1-clcn3	standard conditions	Figure 4 from Zhang et al., 2026

Citations