Morpholino

MO1-inafm2

ID
ZDB-MRPHLNO-260514-1
Name
MO1-inafm2
Previous Names
None
Target
Sequence
5' - CTCTCCATATTGGGCATGTAGTCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-inafm2
No data available
Phenotype
Phenotype resulting from MO1-inafm2
Phenotype Fish Figures
axis length, abnormal WT + MO1-inafm2 Figure 3. with image from Molotkova et al., 2026
cartilage tissue s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
cartilage tissue ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
caudal fin bent, abnormal WT + MO1-inafm2 Figure 3. with image from Molotkova et al., 2026
caudal fin necrotic, abnormal WT + MO1-inafm2 Figure 3. with image from Molotkova et al., 2026
diencephalon icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
forebrain ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
head necrotic, abnormal WT + MO1-inafm2 Figure 3. with image from Molotkova et al., 2026
heart edematous, abnormal WT + MO1-inafm2 Figure 3. with image from Molotkova et al., 2026
heart icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
hindbrain icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
hindbrain s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
hindbrain rspo1 expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
hindbrain ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
iridophore icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
iridophore s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
midbrain ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
midbrain s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
neuron s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
neuron ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
pharyngeal arch s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
photoreceptor cell icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
retina ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
retina rspo1 expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) ctslb expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) icn expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) rspo1 expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
spinal cord interneuron s100t expression increased amount, abnormal WT + MO1-inafm2 Figure 4. with image from Molotkova et al., 2026
Phenotype of all Fish created by or utilizing MO1-inafm2
Phenotype Fish Conditions Figures
caudal fin necrotic, abnormal WT + MO1-inafm2 standard conditions Figure 3. with image from Molotkova et al., 2026
neuron s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
pharyngeal arch s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
midbrain ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) rspo1 expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
retina rspo1 expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
cartilage tissue s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
iridophore icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
spinal cord interneuron s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
midbrain s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
hindbrain icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
neuron ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
hindbrain ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
hindbrain rspo1 expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
spinal cord CNS neuron (sensu Vertebrata) icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
heart edematous, abnormal WT + MO1-inafm2 standard conditions Figure 3. with image from Molotkova et al., 2026
retina ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
cartilage tissue ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
iridophore s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
photoreceptor cell icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
heart icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
midbrain hindbrain boundary ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
caudal fin bent, abnormal WT + MO1-inafm2 standard conditions Figure 3. with image from Molotkova et al., 2026
diencephalon icn expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
head necrotic, abnormal WT + MO1-inafm2 standard conditions Figure 3. with image from Molotkova et al., 2026
forebrain ctslb expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
axis length, abnormal WT + MO1-inafm2 standard conditions Figure 3. with image from Molotkova et al., 2026
hindbrain s100t expression increased amount, abnormal WT + MO1-inafm2 standard conditions Figure 4. with image from Molotkova et al., 2026
Citations