Morpholino

MO2-ddx24

ID
ZDB-MRPHLNO-250808-2
Name
MO2-ddx24
Previous Names
None
Target
Sequence
5' - TTCTTCACCTTCACCTTCATCACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ddx24
No data available
Phenotype
Phenotype resulting from MO2-ddx24
No data available
Phenotype of all Fish created by or utilizing MO2-ddx24
Phenotype Fish Conditions Figures
central artery angiogenic sprout amount, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021, chemical treatment by environment: regorafenib Fig. 6 with image from Chen et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis disrupted, abnormal WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021 Fig. 6 with image from Chen et al., 2025
central artery decreased branchiness, abnormal WT + MO1-ddx24 + MO2-ddx24 standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Chen et al., 2025
whole organism lef1 expression decreased amount, abnormal WT + MO1-ddx24 + MO2-ddx24 standard conditions Fig. 6 with image from Chen et al., 2025
central artery decreased branchiness, exacerbated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: regorafenib Fig. 5 with image from Chen et al., 2025
central artery angiogenic sprout decreased amount, exacerbated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: regorafenib Fig. 5 with image from Chen et al., 2025
central artery angiogenic sprout amount, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021 Fig. 6 with image from Chen et al., 2025
whole organism lef1 expression amount, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021 Fig. 6 with image from Chen et al., 2025
intersegmental vessel mislocalised, abnormal WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021 Fig. 6 with image from Chen et al., 2025
central artery angiogenic sprout decreased amount, abnormal WT + MO1-ddx24 + MO2-ddx24 standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Chen et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis normal process quality, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: regorafenib Fig. 5 with image from Chen et al., 2025
intersegmental vessel localized, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021, chemical treatment by environment: regorafenib Fig. 6 with image from Chen et al., 2025
central artery branchiness, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021, chemical treatment by environment: regorafenib Fig. 6 with image from Chen et al., 2025
central artery branchiness, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021 Fig. 6 with image from Chen et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis disrupted, abnormal WT + MO1-ddx24 + MO2-ddx24 standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Chen et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis normal process quality, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: CHIR 99021, chemical treatment by environment: regorafenib Fig. 6 with image from Chen et al., 2025
intersegmental vessel mislocalised, abnormal WT + MO1-ddx24 + MO2-ddx24 standard conditions Fig. 5 with image,  Fig. 6 with image from Chen et al., 2025
intersegmental vessel localized, ameliorated WT + MO1-ddx24 + MO2-ddx24 chemical treatment by environment: regorafenib Fig. 5 with image from Chen et al., 2025
central artery branching involved in blood vessel morphogenesis disrupted, abnormal WT + MO1-ddx24 + MO1-kdr + MO1-kdrl + MO2-ddx24 standard conditions Fig. 4 with image from Chen et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis normal process quality, ameliorated WT + MO1-ddx24 + MO1-kdr + MO1-kdrl + MO2-ddx24 standard conditions Fig. 4 with image from Chen et al., 2025
central artery angiogenic sprout decreased amount, abnormal WT + MO1-ddx24 + MO1-kdr + MO1-kdrl + MO2-ddx24 standard conditions Fig. 4 with image from Chen et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.