Morpholino

MO3-zfhx4

ID
ZDB-MRPHLNO-250630-4
Name
MO3-zfhx4
Previous Names
None
Target
Sequence
5' - GGATCTCATTTCATCCAGCCTGTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-zfhx4
No data available
Phenotype
Phenotype resulting from MO3-zfhx4
Phenotype Fish Figures
ethmoid cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage EGFP expression decreased distribution, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased size, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage morphology, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage EGFP expression spatial pattern, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage split, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage EGFP expression decreased distribution, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased size, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage morphology, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO3-zfhx4 FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage EGFP expression spatial pattern, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
pericardium edematous, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
whole organism decreased length, abnormal zf4119Tg + MO3-zfhx4 (RW) FIGURE 4 with image from Liu et al., 2024
Phenotype of all Fish created by or utilizing MO3-zfhx4
Phenotype Fish Conditions Figures
ethmoid cartilage morphology, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling decreased distribution, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage split, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased size, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling decreased distribution, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage ab1-col2a labeling spatial pattern, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased size, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage morphology, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage Ab2-zfhx4 labeling spatial pattern, abnormal RW + MO3-zfhx4 control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage EGFP expression spatial pattern, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage morphology, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage EGFP expression decreased distribution, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage split, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
pericardium edematous, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
whole organism decreased length, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage EGFP expression decreased distribution, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage decreased size, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage EGFP expression spatial pattern, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
ethmoid cartilage decreased size, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
Meckel's cartilage morphology, abnormal zf4119Tg + MO3-zfhx4 (RW) control FIGURE 4 with image from Liu et al., 2024
Citations