Morpholino

MO1-kics2

ID
ZDB-MRPHLNO-250513-2
Name
MO1-kics2
Previous Names
None
Target
Sequence
5' - CAGGTCAACAGGCGGTCTCTCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kics2
No data available
Phenotype
Phenotype resulting from MO1-kics2
Phenotype Fish Figures
determination of heart left/right asymmetry decreased process quality, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
determination of pancreatic left/right asymmetry decreased process quality, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
head ab9-rps6 labeling increased amount, abnormal AB/EKW + MO1-kics2 Fig. S8 from Buchert et al., 2025
heart myl7 expression spatial pattern, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
heart looping process quality, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
Kupffer's vesicle motile cilium increased length, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
lateral plate mesoderm spaw expression mislocalised, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
neuromast cilium increased length, abnormal AB/EKW + MO1-kics2 Fig. S9 from Buchert et al., 2025
otolith decreased amount, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
pancreatic bud left side ins expression mislocalised, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
pericardium edematous, abnormal AB/EKW + MO1-kics2 Fig. 6 with image from Buchert et al., 2025
pronephric tubule cilium increased length, abnormal AB/EKW + MO1-kics2 Fig. S9 from Buchert et al., 2025
TORC1 signaling decreased process quality, abnormal AB/EKW + MO1-kics2 Fig. S8 from Buchert et al., 2025
Phenotype of all Fish created by or utilizing MO1-kics2
Phenotype Fish Conditions Figures
pancreatic bud left side ins expression mislocalised, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
neuromast cilium increased length, abnormal AB/EKW + MO1-kics2 control Fig. S9 from Buchert et al., 2025
pericardium edematous, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
lateral plate mesoderm spaw expression mislocalised, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
determination of pancreatic left/right asymmetry decreased process quality, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
heart looping process quality, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
TORC1 signaling decreased process quality, abnormal AB/EKW + MO1-kics2 control Fig. S8 from Buchert et al., 2025
lateral plate mesoderm spaw expression position, ameliorated AB/EKW + MO1-kics2 chemical treatment by environment: sirolimus Fig. 6 with image from Buchert et al., 2025
Kupffer's vesicle motile cilium increased length, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
pronephric tubule cilium increased length, abnormal AB/EKW + MO1-kics2 control Fig. S9 from Buchert et al., 2025
heart myl7 expression spatial pattern, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
otolith decreased amount, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
head ab9-rps6 labeling increased amount, abnormal AB/EKW + MO1-kics2 control Fig. S8 from Buchert et al., 2025
determination of heart left/right asymmetry decreased process quality, abnormal AB/EKW + MO1-kics2 control Fig. 6 with image from Buchert et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.