Morpholino

MO1-jagn1b

ID
ZDB-MRPHLNO-250204-2
Name
MO1-jagn1b
Previous Names
None
Target
Sequence
5' - CATGGCAAACCACCTCCGTCGACAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jagn1b
No data available
Phenotype
Phenotype resulting from MO1-jagn1b
Phenotype Fish Figures
caudal fin apoptotic process increased occurrence, abnormal TU + MO1-jagn1b Fig. 5 with image from Doll et al., 2024
caudal fin neutrophil GFP expression decreased amount, abnormal i114Tg/i114Tg + MO1-jagn1b Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil decreased amount, abnormal i114Tg/i114Tg + MO1-jagn1b Fig. 6 with image from Doll et al., 2024
neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b Fig. 2 with image from Doll et al., 2024
whole organism ppp1r15a expression decreased amount, abnormal TU + MO1-jagn1b Fig. 4 with image from Doll et al., 2024
whole organism cebpb expression increased amount, abnormal TU + MO1-jagn1b Fig. 6 with image from Doll et al., 2024
whole organism ddit3 expression increased amount, abnormal TU + MO1-jagn1b Fig. 4 with image from Doll et al., 2024
whole organism cebpa expression increased amount, abnormal TU + MO1-jagn1b Fig. 6 with image from Doll et al., 2024
whole organism csf3a expression increased amount, abnormal TU + MO1-jagn1b Fig. 6 with image from Doll et al., 2024
whole organism xbp1 expression increased amount, abnormal TU + MO1-jagn1b Fig. 4 with image from Doll et al., 2024
Phenotype of all Fish created by or utilizing MO1-jagn1b
Phenotype Fish Conditions Figures
caudal fin neutrophil GFP expression decreased amount, abnormal i114Tg/i114Tg + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil decreased amount, abnormal i114Tg/i114Tg + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
whole organism ddit3 expression increased amount, abnormal TU + MO1-jagn1b chemical treatment by environment: tunicamycin Fig. 4 with image from Doll et al., 2024
caudal fin neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Doll et al., 2024
whole organism cebpb expression increased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b chemical treatment by environment: 1,4-dithiothreitol Fig. 4 with image from Doll et al., 2024
whole organism ddit3 expression increased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 4 with image from Doll et al., 2024
whole organism ddit3 expression increased amount, abnormal TU + MO1-jagn1b chemical treatment by environment: 1,4-dithiothreitol Fig. 4 with image from Doll et al., 2024
caudal fin apoptotic process increased occurrence, exacerbated TU + MO1-jagn1b chemical treatment by environment: staurosporine Fig. 5 with image from Doll et al., 2024
whole organism csf3a expression increased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 2 with image from Doll et al., 2024
whole organism xbp1 expression increased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 4 with image from Doll et al., 2024
caudal fin neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b chemical treatment by environment: tunicamycin Fig. 4 with image from Doll et al., 2024
whole organism cebpa expression increased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil lyz expression decreased amount, abnormal TU + MO1-jagn1b chemical treatment by environment: staurosporine Fig. 5 with image from Doll et al., 2024
whole organism ppp1r15a expression decreased amount, abnormal TU + MO1-jagn1b standard conditions Fig. 4 with image from Doll et al., 2024
caudal fin apoptotic process increased occurrence, abnormal TU + MO1-jagn1b standard conditions Fig. 5 with image from Doll et al., 2024
caudal fin neutrophil GFP expression decreased amount, abnormal i114Tg/i114Tg + MO1-cebpb + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
caudal fin neutrophil decreased amount, exacerbated i114Tg/i114Tg + MO1-cebpb + MO1-jagn1b standard conditions Fig. 6 with image from Doll et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.