Morpholino
MO3-ttll11
- ID
- ZDB-MRPHLNO-240314-2
- Name
- MO3-ttll11
- Previous Names
- None
- Target
- Sequence
-
5' - CGGCTGATTTGTTATCTCATCTAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ttll11
No data available
Phenotype
Phenotype resulting from MO3-ttll11
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO3-ttll11
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism viability, abnormal | AB + MO3-ttll11 | control |
Fig. 2 ![]() |
whole organism deformed, abnormal | AB + MO3-ttll11 | control |
Fig. 2 ![]() |
cell chromosome segregation decreased process quality, abnormal | AB + MO3-ttll11 | control |
Fig. 3 ![]() |
cell mitotic spindle increased length, abnormal | AB + MO3-ttll11 | control |
Fig. 7 ![]() |
cell tubulin-glutamic acid ligase activity decreased process quality, abnormal | AB + MO3-ttll11 | control |
Fig. 2 ![]() |
1 - 5 of 6 Show all
Citations
- Ten Martin, D., Jardin, N., Vougny, J., Giudicelli, F., Gasmi, L., Berbée, N., Henriot, V., Lebrun, L., Haumaître, C., Kneussel, M., Nicol, X., Janke, C., Magiera, M.M., Hazan, J., Fassier, C. (2024) Tubulin glutamylation regulates axon guidance via the selective tuning of microtubule-severing enzymes. The EMBO journal. 44(1):107-140
- Zadra, I., Jimenez-Delgado, S., Anglada-Girotto, M., Segura-Morales, C., Compton, Z.J., Janke, C., Serrano, L., Ruprecht, V., Vernos, I. (2022) Chromosome segregation fidelity requires microtubule polyglutamylation by the cancer downregulated enzyme TTLL11. Nature communications. 13:71477147
1 - 2 of 2
Show