Morpholino
MO3-bcl6aa
- ID
- ZDB-MRPHLNO-240117-1
- Name
- MO3-bcl6aa
- Previous Names
- None
- Target
- Sequence
-
5' - AGAGCCCACTGTGGAGAAATTATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bcl6aa
No data available
Phenotype
Phenotype resulting from MO3-bcl6aa
Phenotype of all Fish created by or utilizing MO3-bcl6aa
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| leukocyte decreased amount, abnormal | WT + MO3-bcl6aa | control |
Figure 4 |
| macrophage decreased amount, abnormal | gl22Tg + MO3-bcl6aa | control |
Figure 4 |
Citations