Morpholino

MO2-satb2

ID
ZDB-MRPHLNO-231003-1
Name
MO2-satb2
Previous Names
None
Target
Sequence
5' - TGTGAAGTGCCTGATGAGAAAAGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-satb2
No data available
Phenotype
Phenotype resulting from MO2-satb2
No data available
Phenotype of all Fish created by or utilizing MO2-satb2
Phenotype Fish Conditions Figures
whole organism pdgfra expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism xbp1 expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism sema4c expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism cldnb expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism mmp15b expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism runx3 expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism snai1a expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
neural crest cell development premature, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism bmp2b expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism tbx16 expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism cldnb expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism pdgfra expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism bmp2b expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism xbp1 expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism sema4c expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism runx3 expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism mmp15b expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism tbx16 expression increased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
whole organism snai1a expression decreased amount, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
neurogenesis premature, abnormal WT + MO2-satb2 + MO3-satb2 standard conditions Fig. 5 with image from Pradhan et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.