Morpholino
MO1-fars2
- ID
- ZDB-MRPHLNO-230123-1
- Name
- MO1-fars2
- Previous Names
- None
- Target
- Sequence
-
5' - CATAGTAGCTGGTCCATAAGCCTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fars2
No data available
Phenotype
Phenotype resulting from MO1-fars2
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-fars2
1 - 5 of 24 Show all
Citations
- Li, B., Liu, F., Chen, X., Chen, T., Zhang, J., Liu, Y., Yao, Y., Hu, W., Zhang, M., Wang, B., Liu, L., Chen, K., Wu, Y. (2024) FARS2 Deficiency Causes Cardiomyopathy by Disrupting Mitochondrial Homeostasis and the Mitochondrial Quality Control System. Circulation. 149(16):1268-1284
- Chen, X., Liu, F., Li, B., Wang, Y., Yuan, L., Yin, A., Chen, Q., Hu, W., Yao, Y., Zhang, M., Wu, Y., Chen, K. (2022) Neuropathy-associated Fars2 deficiency affects neuronal development and potentiates neuronal apoptosis by impairing mitochondrial function. Cell & Bioscience. 12:103
- Li, B., Chen, K., Liu, F., Zhang, J., Chen, X., Chen, T., Chen, Q., Yao, Y., Hu, W., Wang, L., Wu, Y. (2021) Developmental Angiogenesis Requires the Mitochondrial Phenylalanyl-tRNA Synthetase. Frontiers in cardiovascular medicine. 8:724846
1 - 3 of 3
Show