Morpholino

MO4-grhl3

ID
ZDB-MRPHLNO-221219-1
Name
MO4-grhl3
Previous Names
None
Target
Sequence
5' - TGGTCATGACTCCTTGTACAGGCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-grhl3
No data available
Phenotype
Phenotype resulting from MO4-grhl3
Phenotype of all Fish created by or utilizing MO4-grhl3
Phenotype Fish Conditions Figures
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, abnormal TU + MO4-grhl3 standard conditions Fig 4 with image,  Fig 5 with image from Phatak et al., 2021
epidermal cell cdh1 expression amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell membrane ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell decreased thickness, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling spatial pattern, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell delamination cellular spatiotemporal quality, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
peridermal cell plasma membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell irregular spatial pattern, exacerbated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell cdh1 expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab2-cdh1 labeling amount, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 7 with image from Phatak et al., 2021
epidermal cell ab1-llgl2 labeling increased amount, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
peridermal cell organelle membrane EGFP expression spatial pattern, ameliorated zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
epidermal cell cell division increased frequency, abnormal zf106Tg/zf106Tg + MO1-myo5b + MO4-grhl3 standard conditions Fig 6 with image from Phatak et al., 2021
epidermal cell delamination increased frequency, exacerbated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 5 with image from Phatak et al., 2021
epidermal cell delamination normal frequency, ameliorated TU + MO1-myo5b + MO4-grhl3 standard conditions Fig 4 with image from Phatak et al., 2021
Citations