Morpholino
MO3-alox12
- ID
- ZDB-MRPHLNO-220111-1
- Name
- MO3-alox12
- Previous Names
- None
- Target
- Sequence
-
5' - CCACTGTCACTTTGTACTCCATCTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino was designed against the alox12 sequence NM_199618.1. There is a single nucleotide mismatch between this sequence and the sequence in Ensembl.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-alox12
No data available
Phenotype
Phenotype resulting from MO3-alox12
Phenotype | Fish | Figures |
---|---|---|
whole organism cxcr3.2 expression decreased amount, abnormal | WT + MO3-alox12 |
Figure 6 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-alox12
1 - 4 of 4
Citations
- Kulkarni, A., Pineros, A.R., Walsh, M.A., Casimiro, I., Ibrahim, S., Hernandez-Perez, M., Orr, K.S., Glenn, L., Nadler, J.L., Morris, M.A., Tersey, S.A., Mirmira, R.G., Anderson, R.M. (2021) 12-Lipoxygenase governs the innate immune pathogenesis of islet inflammation and autoimmune diabetes. JCI insight. 6(14):
- Hernandez-Perez, M., Kulkarni, A., Samala, N., Sorrell, C., El, K., Haider, I., Mukhtar Aleem, A., Holman, T.R., Rai, G., Tersey, S.A., Mirmira, R.G., Anderson, R.M. (2020) A 12-lipoxygenase-Gpr31 signaling axis is required for pancreatic organogenesis in the zebrafish. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 34(11):14850-14862
1 - 2 of 2
Show