Morpholino

MO1-pcgf1

ID
ZDB-MRPHLNO-211110-3
Name
MO1-pcgf1
Previous Names
None
Target
Sequence
5' - CCTTGCTCCGCCATCTTTGGGAATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pcgf1
Phenotype
Phenotype resulting from MO1-pcgf1
Phenotype Fish Figures
head decreased size, abnormal WT + MO1-pcgf1 Figure 2 with image from Li et al., 2021
histone H3K4 trimethyltransferase activity decreased occurrence, abnormal WT + MO1-pcgf1 Figure 7 with image from Li et al., 2021
histone H3K27 trimethyltransferase activity decreased occurrence, abnormal WT + MO1-pcgf1 Figure 7 with image from Li et al., 2021
telencephalon decreased size, abnormal WT + MO1-pcgf1 Figure 2 with image from Li et al., 2021
telencephalon malformed, abnormal WT + MO1-pcgf1 Figure 2 with image from Li et al., 2021
whole organism otx2b expression decreased amount, abnormal WT + MO1-pcgf1 Figure 4 with image from Li et al., 2021
whole organism smad5 expression decreased amount, abnormal WT + MO1-pcgf1 Figure 7 with image from Li et al., 2021
whole organism smad1 expression decreased amount, abnormal WT + MO1-pcgf1 Figure 7 with image from Li et al., 2021
whole organism smad4a expression decreased amount, abnormal WT + MO1-pcgf1 Figure 7 with image from Li et al., 2021
whole organism sox2 expression decreased amount, abnormal WT + MO1-pcgf1 Figure 4 with image from Li et al., 2021
whole organism neurog1 expression decreased amount, abnormal WT + MO1-pcgf1 Figure 4 with image from Li et al., 2021
whole organism sox3 expression decreased amount, abnormal WT + MO1-pcgf1 Figure 3 with imageFigure 4 with image from Li et al., 2021
whole organism neurog1 expression increased amount, abnormal WT + MO1-pcgf1 Figure 3 with image from Li et al., 2021
whole organism sox3 expression increased amount, abnormal WT + MO1-pcgf1 Figure 3 with image from Li et al., 2021
whole organism cdkn1ca expression increased amount, abnormal WT + MO1-pcgf1 Figure 4 with image from Li et al., 2021
whole organism sox2 expression increased amount, abnormal WT + MO1-pcgf1 Figure 3 with image from Li et al., 2021
whole organism cdkn1a expression increased amount, abnormal WT + MO1-pcgf1 Figure 4 with image from Li et al., 2021
whole organism otx2b expression increased amount, abnormal WT + MO1-pcgf1 Figure 3 with image from Li et al., 2021
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-pcgf1 Figure 2 with image from Li et al., 2021
Phenotype of all Fish created by or utilizing MO1-pcgf1
Phenotype Fish Conditions Figures
whole organism smad1 expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 7 with image from Li et al., 2021
whole organism neurog1 expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 3 with image from Li et al., 2021
whole organism cdkn1ca expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 4 with image from Li et al., 2021
whole organism smad5 expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 7 with image from Li et al., 2021
whole organism otx2b expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 3 with image from Li et al., 2021
whole organism cdkn1a expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 4 with image from Li et al., 2021
whole organism sox2 expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 3 with image from Li et al., 2021
whole organism sox2 expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 4 with image from Li et al., 2021
whole organism neurog1 expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 4 with image from Li et al., 2021
head decreased size, abnormal WT + MO1-pcgf1 standard conditions Figure 2 with image from Li et al., 2021
whole organism sox3 expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 3 with imageFigure 4 with image from Li et al., 2021
whole organism sox3 expression increased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 3 with image from Li et al., 2021
telencephalon decreased size, abnormal WT + MO1-pcgf1 standard conditions Figure 2 with image from Li et al., 2021
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-pcgf1 standard conditions Figure 2 with image from Li et al., 2021
whole organism smad4a expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 7 with image from Li et al., 2021
histone H3K4 trimethyltransferase activity decreased occurrence, abnormal WT + MO1-pcgf1 standard conditions Figure 7 with image from Li et al., 2021
telencephalon malformed, abnormal WT + MO1-pcgf1 standard conditions Figure 2 with image from Li et al., 2021
whole organism otx2b expression decreased amount, abnormal WT + MO1-pcgf1 standard conditions Figure 4 with image from Li et al., 2021
histone H3K27 trimethyltransferase activity decreased occurrence, abnormal WT + MO1-pcgf1 standard conditions Figure 7 with image from Li et al., 2021
Citations