Morpholino
MO3-gad1b
- ID
- ZDB-MRPHLNO-210830-2
- Name
- MO3-gad1b
- Previous Names
- None
- Target
- Sequence
-
5' - TTTGTGATCAGTTTACCAGGTGAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-gad1b
No data available
Phenotype
Phenotype resulting from MO3-gad1b
| Phenotype | Fish | Figures |
|---|---|---|
| swimming behavior increased process quality, abnormal | AB + MO3-gad1b |
Fig. 4  ,
Fig. 5
from Lüffe et al., 2021 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-gad1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| swimming behavior increased process quality, abnormal | AB + MO3-gad1b | chemical treatment by environment: methylphenidate |
Fig. 5
from Lüffe et al., 2021 |
| swimming behavior increased process quality, abnormal | AB + MO3-gad1b | control |
Fig. 4 ,
Fig. 5
from Lüffe et al., 2021 |
1 - 2 of 2
Citations
- Lüffe, T.M., D'Orazio, A., Bauer, M., Gioga, Z., Schoeffler, V., Lesch, K.P., Romanos, M., Drepper, C., Lillesaar, C. (2021) Increased locomotor activity via regulation of GABAergic signalling in foxp2 mutant zebrafish-implications for neurodevelopmental disorders. Translational psychiatry. 11:529
- Segebarth, D., Griebel, M., Stein, N., R von Collenberg, C., Martin, C., Fiedler, D., Comeras, L.B., Sah, A., Schoeffler, V., Lüffe, T., Dürr, A., Gupta, R., Sasi, M., Lillesaar, C., Lange, M.D., Tasan, R.O., Singewald, N., Pape, H.C., Flath, C.M., Blum, R. (2020) On the objectivity, reliability, and validity of deep learning enabled bioimage analyses. eLIFE. 9:
1 - 2 of 2
Show