Morpholino

MO1-man1a2

ID

ZDB-MRPHLNO-210712-1

Name

MO1-man1a2

Previous Names

None

Target

man1a2 (1)

Sequence

5' - CCGGCGTGGTCATATTTTGATGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-man1a2

Expressed Gene	Anatomy	Figures
cp	liver	Fig. S7 from So et al., 2020
fabp10a	liver	Fig. S7 from So et al., 2020
foxa3	liver pancreatic bud dorsal region	FIGURE 3 from So et al., 2020
myl7	heart tube	FIGURE 3 from So et al., 2020
prox1a	liver	Fig. S7 from So et al., 2020
selenop2	liver	Fig. S7 from So et al., 2020

Phenotype

Phenotype resulting from MO1-man1a2

Phenotype	Fish	Figures
bile canaliculus cholangiocyte aggregated, abnormal	s939Tg + MO1-man1a2	Fig. S5 from So et al., 2020
cholangiocyte filopodium decreased length, abnormal	um14Tg + MO1-man1a2	Fig. S5 from So et al., 2020
gall bladder phospholipid decreased amount, abnormal	WT + MO1-man1a2	FIGURE 2 from So et al., 2020
heart tube myl7 expression spatial pattern, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020
heart tube embryonic heart tube left/right pattern formation disrupted, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020
heart tube heart looping disrupted, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020
Kupffer's vesicle cilium decreased amount, abnormal	pt6Tg + MO1-man1a2	FIGURE 3 from So et al., 2020
Kupffer's vesicle cilium ab1-tuba labeling decreased distribution, abnormal	pt6Tg + MO1-man1a2	FIGURE 3 from So et al., 2020
Kupffer's vesicle cilium decreased length, abnormal	pt6Tg + MO1-man1a2	FIGURE 3 from So et al., 2020
liver fabp10a expression spatial pattern, abnormal	WT + MO1-man1a2	Fig. S7 from So et al., 2020
liver selenop2 expression spatial pattern, abnormal	WT + MO1-man1a2	Fig. S7 from So et al., 2020
liver foxa3 expression spatial pattern, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020
liver prox1a expression spatial pattern, abnormal	WT + MO1-man1a2	Fig. S7 from So et al., 2020
liver cp expression spatial pattern, abnormal	WT + MO1-man1a2	Fig. S7 from So et al., 2020
liver determination of liver left/right asymmetry disrupted, abnormal	WT + MO1-man1a2	Fig. S7, FIGURE 3 from So et al., 2020
liver and biliary system disconnected, abnormal	s939Tg + MO1-man1a2	FIGURE 2 from So et al., 2020
pancreatic bud determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020
pancreatic bud dorsal region foxa3 expression spatial pattern, abnormal	WT + MO1-man1a2	FIGURE 3 from So et al., 2020

Phenotype of all Fish created by or utilizing MO1-man1a2

Phenotype	Fish	Conditions	Figures
gall bladder phospholipid decreased amount, abnormal	WT + MO1-man1a2	control	FIGURE 2 from So et al., 2020
liver prox1a expression spatial pattern, abnormal	WT + MO1-man1a2	control	Fig. S7 from So et al., 2020
liver determination of liver left/right asymmetry disrupted, abnormal	WT + MO1-man1a2	control	Fig. S7, FIGURE 3 from So et al., 2020
heart tube embryonic heart tube left/right pattern formation disrupted, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
liver selenop2 expression spatial pattern, abnormal	WT + MO1-man1a2	control	Fig. S7 from So et al., 2020
pancreatic bud determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
pancreatic bud dorsal region foxa3 expression spatial pattern, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
liver cp expression spatial pattern, abnormal	WT + MO1-man1a2	control	Fig. S7 from So et al., 2020
liver foxa3 expression spatial pattern, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
liver fabp10a expression spatial pattern, abnormal	WT + MO1-man1a2	control	Fig. S7 from So et al., 2020
heart tube heart looping disrupted, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
heart tube myl7 expression spatial pattern, abnormal	WT + MO1-man1a2	control	FIGURE 3 from So et al., 2020
gall bladder phospholipid decreased amount, abnormal	WT + MO1-man1a2	chemical treatment: epidermal growth factor receptor antagonist	FIGURE 4 from So et al., 2020
Kupffer's vesicle cilium ab1-tuba labeling decreased distribution, abnormal	pt6Tg + MO1-man1a2	control	FIGURE 3 from So et al., 2020
Kupffer's vesicle cilium decreased amount, abnormal	pt6Tg + MO1-man1a2	control	FIGURE 3 from So et al., 2020
Kupffer's vesicle cilium decreased length, abnormal	pt6Tg + MO1-man1a2	control	FIGURE 3 from So et al., 2020
liver and biliary system disconnected, abnormal	s939Tg + MO1-man1a2	control	FIGURE 2 from So et al., 2020
intrahepatic bile duct disconnected, abnormal	s939Tg + MO1-man1a2	chemical treatment: epidermal growth factor receptor antagonist	FIGURE 4 from So et al., 2020
bile canaliculus cholangiocyte aggregated, abnormal	s939Tg + MO1-man1a2	control	Fig. S5 from So et al., 2020
cholangiocyte filopodium decreased length, abnormal	um14Tg + MO1-man1a2	control	Fig. S5 from So et al., 2020
gall bladder phospholipid decreased amount, abnormal	WT + MO1-arf6a,arf6b + MO1-man1a2	control	FIGURE 4 from So et al., 2020
intrahepatic bile duct disconnected, abnormal	s939Tg + MO1-arf6a,arf6b + MO1-man1a2	control	FIGURE 4 from So et al., 2020

Citations