Morpholino
MO1-col11a1a
- ID
- ZDB-MRPHLNO-210412-1
- Name
- MO1-col11a1a
- Previous Names
- None
- Target
- Sequence
-
5' - GGGACCACCTTGGCCTCTCCATGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-col11a1a
No data available
Phenotype
Phenotype resulting from MO1-col11a1a
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO1-col11a1a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism decreased length, abnormal | AB + MO1-col11a1a | control |
Fig. 5,
Table 3
from Hardy et al., 2020 |
cranial cartilage disorganized, abnormal | AB + MO1-col11a1a | control |
Fig. 7
from Hardy et al., 2020 |
otolith increased amount, abnormal | AB + MO1-col11a1a | control |
Table 4
from Hardy et al., 2020 |
Meckel's cartilage decreased size, abnormal | AB + MO1-col11a1a | control |
Table 4
from Hardy et al., 2020 |
mandibular arch skeleton decreased size, abnormal | AB + MO1-col11a1a | standard conditions |
Figure 1 ![]() |
1 - 5 of 18 Show all
Citations
- Reeck, J.C., Oxford, J.T. (2022) The Shape of the Jaw-Zebrafish Col11a1a Regulates Meckel's Cartilage Morphogenesis and Mineralization. Journal of developmental biology. 10(4):
- Hardy, M.J., Reeck, J.C., Fang, M., Adams, J.S., Oxford, J.T. (2020) Col11a1a Expression Is Required for Zebrafish Development. Journal of developmental biology. 8(3):
1 - 2 of 2
Show