Morpholino
MO3-pgk1
- ID
- ZDB-MRPHLNO-210223-6
- Name
- MO3-pgk1
- Previous Names
- None
- Target
- Sequence
-
5' - GTCAGTTGGCATTTCTGTGTGGACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This sequence appears to target multiple places in the genome. The author was contacted and verified that the sequence is correct and provided this information. "This exon seems to reflect an ancient transposon integration into the first intron of pgk1, and we noted a number of similar sequences throughout the genome. However, the sequence shows wide variation, and in most cases it appears that the coding region in exon 2 has not been maintained. So these other sequences may not be expressed, or if they are they may not be functional. " - Bruce B. Riley
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pgk1
No data available
Phenotype
Phenotype resulting from MO3-pgk1
Phenotype | Fish | Figures |
---|---|---|
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal | zc7Tg + MO3-pgk1 + MO4-tp53 |
Figure 3 - figure supplement 3
from Kantarci et al., 2020 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-pgk1
1 - 2 of 2
Citations