Morpholino
MO1-mapda
- ID
- ZDB-MRPHLNO-200806-1
- Name
- MO1-mapda
- Previous Names
-
- MO1-adal
- Target
- Sequence
-
5' - AAAGAGATCCGCTTCGGTGTCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mapda
No data available
Phenotype
Phenotype resulting from MO1-mapda
| Phenotype | Fish | Figures |
|---|---|---|
| eye decreased size, abnormal | AB + MO1-mapda |
Fig. 2
from Chiang et al., 2019 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-mapda
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| eye decreased size, abnormal | AB + MO1-mapda | standard conditions |
Fig. 2
from Chiang et al., 2019 |
1 - 1 of 1
Citations
- Gessler, S., Guthmann, C., Schuler, V., Lilienkamp, M., Walz, G., Yakulov, T.A. (2022) Control of Directed Cell Migration after Tubular Cell Injury by Nucleotide Signaling. International Journal of Molecular Sciences. 23(14):
- Chiang, C.Y., Ching, Y.H., Chang, T.Y., Hu, L.S., Yong, Y.S., Keak, P.Y., Mustika, I., Lin, M.D., Liao, B.Y. (2019) Novel eye genes systematically discovered through an integrated analysis of mouse transcriptomes and phenome. Computational and structural biotechnology journal. 18:73-82
1 - 2 of 2
Show