Morpholino

MO2-greb1

ID

ZDB-MRPHLNO-200804-2

Name

MO2-greb1

Previous Names

Target

Sequence

5' - AATACTGAAATCACACCTCTCCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-greb1

Expressed Gene	Anatomy	Figures
her7	(not) segmental plate (not) tail bud	Fig. 3. from Prajapati et al., 2020
mespaa	somite	Fig. 3. from Prajapati et al., 2020
mespba	somite	Fig. 3. from Prajapati et al., 2020
myod1	somite	Fig. 3. from Prajapati et al., 2020
pcdh8	somite	Fig. 3. from Prajapati et al., 2020
tbxta	tail bud	Fig. 3. from Prajapati et al., 2020
xirp2a	vertical myoseptum	Fig. 3. from Prajapati et al., 2020

Phenotype

Phenotype resulting from MO2-greb1

Phenotype	Fish	Figures
segmental plate her7 expression absent, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
somite pcdh8 expression decreased amount, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
somite mespba expression decreased amount, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
somite myod1 expression increased distribution, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
somite morphology, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
somite myod1 expression spatial pattern, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
tail bud her7 expression absent, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
tail bud tbxta expression decreased amount, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
vertical myoseptum xirp2a expression decreased amount, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020
vertical myoseptum xirp2a expression spatial pattern, abnormal	WT + MO2-greb1	Fig. 3. from Prajapati et al., 2020

Phenotype of all Fish created by or utilizing MO2-greb1

Phenotype	Fish	Conditions	Figures
segmental plate her7 expression absent, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
vertical myoseptum xirp2a expression spatial pattern, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
somite morphology, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
vertical myoseptum xirp2a expression decreased amount, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
somite mespba expression decreased amount, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
somite myod1 expression spatial pattern, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
somite pcdh8 expression decreased amount, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
tail bud her7 expression absent, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
tail bud tbxta expression decreased amount, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020
somite myod1 expression increased distribution, abnormal	WT + MO2-greb1	standard conditions	Fig. 3. from Prajapati et al., 2020

Citations