Morpholino
MO1-adamts18
- ID
- ZDB-MRPHLNO-200505-2
- Name
- MO1-adamts18
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGCAGACACTTACCAAACCTGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adamts18
No data available
Phenotype
Phenotype resulting from MO1-adamts18
1 - 5 of 26 Show all
Phenotype of all Fish created by or utilizing MO1-adamts18
1 - 5 of 26 Show all
Citations
- Lin, Y., Yang, Q., Lin, X., Liu, X., Qian, Y., Xu, D., Cao, N., Han, X., Zhu, Y., Hu, W., He, X., Yu, Z., Kong, X., Zhu, L., Zhong, Z., Liu, K., Zhou, B., Wang, Y., Peng, J., Zhu, W., Wang, J. (2023) Extracellular Matrix Disorganization Caused by ADAMTS16 Deficiency Leads to Bicuspid Aortic Valve With Raphe Formation. Circulation. 149(8):605-626
- Lu, T., Zhang, T., Wang, C., Yang, N., Pan, Y.H., Dang, S., Zhang, W. (2019) Adamts18 deficiency in zebrafish embryo causes defective trunk angiogenesis and caudal vein plexus formation. Biochemical and Biophysical Research Communications. 521(4):907-913
1 - 2 of 2
Show