Morpholino

MO1-got2a

ID
ZDB-MRPHLNO-200225-3
Name
MO1-got2a
Previous Names
None
Target
Sequence
5' - CTTGCTGGATTTGAACAGGGCCATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-got2a
No data available
Phenotype
Phenotype resulting from MO1-got2a
Phenotype Fish Figures
blood circulation decreased rate, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
brain cell communication by electrical coupling disrupted, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
head decreased size, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
whole organism curved, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
whole organism viability, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a Fig. 5 from van Karnebeek et al., 2019
Phenotype of all Fish created by or utilizing MO1-got2a
Phenotype Fish Conditions Figures
whole organism curved, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
whole organism curved, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a chemical treatment by environment: pyridoxine, chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
head decreased size, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
whole organism viability, abnormal WT + MO1-got2a chemical treatment by environment: sodium pyruvate Fig. 5 from van Karnebeek et al., 2019
head decreased size, ameliorated WT + MO1-got2a chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
head decreased size, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine, chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
whole organism viability, ameliorated WT + MO1-got2a chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
blood circulation decreased rate, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
whole organism viability, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, ameliorated WT + MO1-got2a chemical treatment by environment: sodium pyruvate Fig. 5 from van Karnebeek et al., 2019
head decreased size, abnormal WT + MO1-got2a chemical treatment by environment: L-proline Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a chemical treatment by environment: L-proline Fig. 5 from van Karnebeek et al., 2019
whole organism curved, ameliorated WT + MO1-got2a chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
whole organism curved, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine, chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, abnormal WT + MO1-got2a chemical treatment by environment: L-proline Fig. 5 from van Karnebeek et al., 2019
whole organism viability, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
head decreased size, ameliorated WT + MO1-got2a chemical treatment by environment: sodium pyruvate Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
brain cell communication by electrical coupling disrupted, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
whole organism curved, abnormal WT + MO1-got2a chemical treatment by environment: L-proline Fig. 5 from van Karnebeek et al., 2019
head decreased size, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a chemical treatment by environment: sodium pyruvate Fig. 5 from van Karnebeek et al., 2019
yolk increased size, abnormal WT + MO1-got2a standard conditions Fig. 5 from van Karnebeek et al., 2019
whole organism viability, abnormal WT + MO1-got2a chemical treatment by environment: L-proline Fig. 5 from van Karnebeek et al., 2019
whole organism curved, ameliorated WT + MO1-got2a chemical treatment by environment: sodium pyruvate Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, ameliorated WT + MO1-got2a chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
pericardium edematous, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine, chemical treatment by environment: serine Fig. 5 from van Karnebeek et al., 2019
brain cell communication by electrical coupling disrupted, ameliorated WT + MO1-got2a chemical treatment by environment: pyridoxine Fig. 5 from van Karnebeek et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.