Morpholino

MO3-amer1

ID
ZDB-MRPHLNO-200225-2
Name
MO3-amer1
Previous Names
  • wtx-ATG (1)
Target
Sequence
5' - ACAGGTGACTGTGGCTAATGGAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-amer1
No data available
Phenotype
Phenotype resulting from MO3-amer1
Phenotype of all Fish created by or utilizing MO3-amer1
Phenotype Fish Conditions Figures
midbrain hindbrain boundary neural plate pax2a expression increased distribution, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
somite myod1 expression spatial pattern, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
anterior neural rod six3b expression increased distribution, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression spatial pattern, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
somite myod1 expression increased distribution, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
anterior neural rod six3b expression spatial pattern, abnormal WT + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
margin GFP expression increased amount, abnormal w25Tg/+ + MO3-amer1 standard conditions Fig. 2 with image from Große et al., 2019
somite myod1 expression increased distribution, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
anterior neural rod six3b expression spatial pattern, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
somite myod1 expression spatial pattern, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression spatial pattern, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
midbrain hindbrain boundary neural plate pax2a expression increased distribution, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
anterior neural rod six3b expression increased distribution, abnormal amer1li17/li17; amer2li18/li18; amer3li20/li20 + MO3-amer1 standard conditions Fig. 6 with image from Große et al., 2019
Citations