Morpholino
MO1-ednrbb
- ID
- ZDB-MRPHLNO-191021-5
- Name
- MO1-ednrbb
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - GCAGCAGAATGACCGATGATGCCAT - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO1-ednrbb
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO1-ednrbb
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Figures | 
|---|---|---|
| gut enteric neuron decreased amount, abnormal | AB + MO1-ednrbb | Fig. S7
                    
                    from Tilghman et al., 2019 | 
                
                    
                        Phenotype of all Fish created by or utilizing MO1-ednrbb
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| gut enteric neuron decreased amount, abnormal | AB + MO1-ednrbb | standard conditions | Fig. S7
                    
                    from Tilghman et al., 2019 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    